ID: 1039936790

View in Genome Browser
Species Human (GRCh38)
Location 8:42052214-42052236
Sequence CCGGCCCCACGTGACCCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039936790_1039936798 5 Left 1039936790 8:42052214-42052236 CCGGCGGGGTCACGTGGGGCCGG No data
Right 1039936798 8:42052242-42052264 AAGGCCAAAGCCAGGGGAGGAGG No data
1039936790_1039936796 -1 Left 1039936790 8:42052214-42052236 CCGGCGGGGTCACGTGGGGCCGG No data
Right 1039936796 8:42052236-42052258 GTACAAAAGGCCAAAGCCAGGGG No data
1039936790_1039936801 14 Left 1039936790 8:42052214-42052236 CCGGCGGGGTCACGTGGGGCCGG No data
Right 1039936801 8:42052251-42052273 GCCAGGGGAGGAGGAGGACTTGG No data
1039936790_1039936795 -2 Left 1039936790 8:42052214-42052236 CCGGCGGGGTCACGTGGGGCCGG No data
Right 1039936795 8:42052235-42052257 GGTACAAAAGGCCAAAGCCAGGG No data
1039936790_1039936806 23 Left 1039936790 8:42052214-42052236 CCGGCGGGGTCACGTGGGGCCGG No data
Right 1039936806 8:42052260-42052282 GGAGGAGGACTTGGTGGGGCTGG No data
1039936790_1039936797 2 Left 1039936790 8:42052214-42052236 CCGGCGGGGTCACGTGGGGCCGG No data
Right 1039936797 8:42052239-42052261 CAAAAGGCCAAAGCCAGGGGAGG No data
1039936790_1039936794 -3 Left 1039936790 8:42052214-42052236 CCGGCGGGGTCACGTGGGGCCGG No data
Right 1039936794 8:42052234-42052256 CGGTACAAAAGGCCAAAGCCAGG No data
1039936790_1039936804 18 Left 1039936790 8:42052214-42052236 CCGGCGGGGTCACGTGGGGCCGG No data
Right 1039936804 8:42052255-42052277 GGGGAGGAGGAGGACTTGGTGGG No data
1039936790_1039936808 30 Left 1039936790 8:42052214-42052236 CCGGCGGGGTCACGTGGGGCCGG No data
Right 1039936808 8:42052267-42052289 GACTTGGTGGGGCTGGAGGCTGG No data
1039936790_1039936799 8 Left 1039936790 8:42052214-42052236 CCGGCGGGGTCACGTGGGGCCGG No data
Right 1039936799 8:42052245-42052267 GCCAAAGCCAGGGGAGGAGGAGG No data
1039936790_1039936803 17 Left 1039936790 8:42052214-42052236 CCGGCGGGGTCACGTGGGGCCGG No data
Right 1039936803 8:42052254-42052276 AGGGGAGGAGGAGGACTTGGTGG No data
1039936790_1039936807 26 Left 1039936790 8:42052214-42052236 CCGGCGGGGTCACGTGGGGCCGG No data
Right 1039936807 8:42052263-42052285 GGAGGACTTGGTGGGGCTGGAGG No data
1039936790_1039936805 19 Left 1039936790 8:42052214-42052236 CCGGCGGGGTCACGTGGGGCCGG No data
Right 1039936805 8:42052256-42052278 GGGAGGAGGAGGACTTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039936790 Original CRISPR CCGGCCCCACGTGACCCCGC CGG (reversed) Intergenic
No off target data available for this crispr