ID: 1039949009

View in Genome Browser
Species Human (GRCh38)
Location 8:42153263-42153285
Sequence CTTCCCGGCGCCGCGGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039949003_1039949009 4 Left 1039949003 8:42153236-42153258 CCGGGTTCAGAGTTCGGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1039949009 8:42153263-42153285 CTTCCCGGCGCCGCGGCTGCGGG 0: 1
1: 0
2: 1
3: 15
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039949009 Original CRISPR CTTCCCGGCGCCGCGGCTGC GGG Intronic
900627069 1:3613219-3613241 CTTCCCGGGATCTCGGCTGCAGG + Intergenic
900677912 1:3900135-3900157 CTGCCCGGCGCAGCTGCTGCCGG + Intronic
901057468 1:6455364-6455386 CTGCCCCGCGTGGCGGCTGCCGG + Intronic
901636823 1:10674410-10674432 TTCCCCGGCACCGCTGCTGCGGG + Intronic
902582877 1:17419987-17420009 CTGCCAGGCGCTGCGGCTGCAGG + Intronic
903228028 1:21904757-21904779 CTGCCAGGCACCACGGCTGCCGG + Intronic
903366594 1:22809098-22809120 CTTCCCGGCGGTGCCTCTGCAGG + Intronic
903652324 1:24929785-24929807 CTTGCCGCCGCCGCCGCCGCAGG + Exonic
903703285 1:25266913-25266935 CCTCCCGGACCGGCGGCTGCAGG + Intronic
903712550 1:25337242-25337264 CCTCCCGGACCGGCGGCTGCAGG + Intronic
904499881 1:30907855-30907877 CTTCCCAGGGTCGCGGCAGCCGG - Intronic
905013429 1:34761917-34761939 ATTCCCGGCACCGAGGCCGCCGG - Exonic
905648302 1:39639748-39639770 CTTTCCTGCGCCGCAGCTCCGGG + Exonic
905676738 1:39831389-39831411 CTTCCCCGCCCCCCGGCTGTGGG - Intergenic
906129765 1:43449085-43449107 CTCCCAGGTGCTGCGGCTGCTGG - Intronic
907216622 1:52869980-52870002 CTCCCGGGCGGGGCGGCTGCCGG + Intronic
910963426 1:92785013-92785035 CCTCCCGGCACCGCCGCTGTCGG + Intronic
913131090 1:115838876-115838898 CCCTCGGGCGCCGCGGCTGCCGG - Exonic
914386263 1:147172605-147172627 GTCCCGGGCGCCGAGGCTGCAGG - Intergenic
915165676 1:153946576-153946598 GTCCCCGGCGCCGCGGGAGCTGG - Exonic
918299131 1:183186286-183186308 CTGCCCGGCGCCTCGGTTGGTGG - Exonic
920394167 1:205631815-205631837 TCTCCCGCCGCCGCGGCTCCTGG + Exonic
921207238 1:212858935-212858957 CTTCCCGGCCACCTGGCTGCTGG + Exonic
1062835878 10:635471-635493 CTTCCCGGCCTCGCCCCTGCTGG - Intronic
1064202914 10:13299789-13299811 CTTCCCCGCTCCCCGGCTCCTGG + Intronic
1065937020 10:30529669-30529691 CTACCCAGCGCCGCGGCTCTCGG + Intergenic
1070327693 10:75399224-75399246 CTAACGGCCGCCGCGGCTGCTGG - Exonic
1070801450 10:79246679-79246701 CTTCCCCAAGCCTCGGCTGCAGG + Intronic
1072241174 10:93496736-93496758 CGGCCCGGCCCCGGGGCTGCGGG - Exonic
1074377688 10:112952397-112952419 CTGCCCGGCGCACTGGCTGCGGG + Intronic
1075519456 10:123135290-123135312 CTTCCCGCCGCCAGGCCTGCGGG - Intergenic
1076792465 10:132784676-132784698 GTTCCCGGTGCGGAGGCTGCGGG - Intergenic
1076869628 10:133187001-133187023 CATCACGGAGCCGGGGCTGCTGG - Intronic
1076875546 10:133213900-133213922 CTGCCCGGCCCTGGGGCTGCTGG - Intronic
1076993855 11:289132-289154 CTTCCTGGTGGCGCGGCAGCCGG + Exonic
1077499288 11:2902025-2902047 CTGCCCGGTGCCCGGGCTGCTGG - Intronic
1083894490 11:65613396-65613418 CTTCCAGGAGCTGCGGCTGGAGG - Exonic
1084069949 11:66727823-66727845 CCTCGCGTCGCCGGGGCTGCGGG - Intronic
1084522909 11:69675352-69675374 CTGCCCCGCGCCGCCGCTTCCGG - Intronic
1086888257 11:92226825-92226847 CCTCCCGCCGCGGCTGCTGCAGG - Intergenic
1088462294 11:110093712-110093734 CTTCCCGGCCCCGCGGCCTAAGG + Intronic
1089535970 11:119161043-119161065 CTTCCTAGCCCTGCGGCTGCTGG + Exonic
1091718557 12:2795945-2795967 CCTCCCGGAGCCAGGGCTGCGGG + Intronic
1094375381 12:29783683-29783705 CCTCCCGGCGGCGGGGCTGCGGG - Exonic
1094841702 12:34345066-34345088 GTTCCCGCCGCCGGAGCTGCTGG - Intergenic
1095097450 12:38156031-38156053 GTGCCCGGCGCAGGGGCTGCCGG - Intergenic
1096475530 12:51907053-51907075 CTTCCCGGCGCCCCGATTCCAGG + Intronic
1096968649 12:55648354-55648376 CTCCCCGACGGGGCGGCTGCCGG + Intergenic
1101970453 12:109309130-109309152 CCTCGCGGGGCCGCCGCTGCCGG + Exonic
1103595346 12:122021795-122021817 CCTCCGGGCGCCGCGGCCACCGG - Exonic
1107454025 13:40537653-40537675 CTTCCTGGCGGCGGGGCTGTGGG - Intergenic
1108024417 13:46162984-46163006 CTCCCCGACGGGGCGGCTGCCGG - Intronic
1110705281 13:78596908-78596930 CTTCCTGCCACCGCGGCTTCTGG - Intergenic
1112730993 13:102362056-102362078 CTTCCTGGGGCCACTGCTGCTGG + Intronic
1113055978 13:106268532-106268554 GTTCCCGGGGCTGTGGCTGCTGG - Intergenic
1114452590 14:22836945-22836967 CTTCCCGGAGTCGCGCCCGCCGG + Intronic
1115754571 14:36518900-36518922 CCTGCCGGCGCCGCGCCTTCTGG + Intronic
1116835661 14:49767603-49767625 CTGCCGGGCGCCGCCTCTGCGGG - Exonic
1117722180 14:58638419-58638441 CTGCGCGGCGCCGGGGGTGCGGG + Exonic
1119519747 14:75277276-75277298 CTCCCGGGCGCGGCGGCTGGAGG + Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1119520151 14:75279134-75279156 CTTCCCGTCGCCGCGGGGCCGGG + Intronic
1120881188 14:89416697-89416719 CTTCCCGGCTCGGGGGCTCCCGG + Intronic
1122884335 14:104703908-104703930 CTTCCCAGGGCTGCAGCTGCTGG + Exonic
1123709953 15:22980130-22980152 CTCCCCGGCGGCGCGGCCTCCGG - Intronic
1127071351 15:55290322-55290344 CTTCCCGCCCCTGCGGCTCCTGG + Intronic
1127342707 15:58065104-58065126 CTTCCGGGCCCCTCGGCTGTTGG - Intronic
1129856917 15:78831143-78831165 CGTCCGGGCGCCGGCGCTGCGGG + Intronic
1130957702 15:88639124-88639146 CTTCCCGGTCCCCAGGCTGCGGG + Intronic
1131277621 15:90994891-90994913 CTTCCCTGAGTCCCGGCTGCCGG + Intronic
1132719842 16:1310067-1310089 CCTCGCGGGGCCCCGGCTGCAGG - Intronic
1133004091 16:2868247-2868269 CTTCCGGCCGCAGAGGCTGCCGG + Intergenic
1135521705 16:23182938-23182960 CTTCCCGGTGCCCGGGATGCTGG + Intronic
1136536341 16:30902113-30902135 CTTCTCGCCGCCGCGGCTGCCGG + Exonic
1137426544 16:48385293-48385315 CTTCCCGGCGCCGAGACCGACGG + Intronic
1140025791 16:71289319-71289341 CTTCCCGGTGCCGCGAGGGCGGG - Intronic
1140440643 16:74985027-74985049 CGTCCTGGGGCCGCGGCGGCCGG - Exonic
1141958826 16:87391609-87391631 GTTCCAGGCGCCGCGGCAGGGGG + Intronic
1142676588 17:1517072-1517094 CTCCCCCGCCCCCCGGCTGCAGG + Intergenic
1142757507 17:2024764-2024786 CCGCCCGGCGCCGGGGCTCCCGG - Intronic
1142810383 17:2393190-2393212 CTCCGCGTCTCCGCGGCTGCCGG + Intronic
1143519410 17:7437110-7437132 CATACCAGCGCCGCTGCTGCAGG + Exonic
1147369307 17:39980805-39980827 CTTCCCGGCGCTGGGCCTTCTGG - Exonic
1147805329 17:43126922-43126944 CTGCCCGGGGCCGGGGGTGCGGG - Intergenic
1150259217 17:63774504-63774526 CTTCCCGGCACCCCGGCCGCCGG - Intronic
1150692762 17:67378913-67378935 GGTGCCGGGGCCGCGGCTGCCGG + Intronic
1151611936 17:75182332-75182354 CTGCCTGGGGCCGCGGCGGCGGG - Intergenic
1151747450 17:76018994-76019016 CATCCCGGCTTCGCCGCTGCAGG + Exonic
1151802310 17:76385483-76385505 CCGCCCGGAGCCGTGGCTGCAGG - Exonic
1152325462 17:79633386-79633408 CTCCCCGGGGCGGCAGCTGCAGG + Intergenic
1152396265 17:80035652-80035674 CTCCCCGGTCCCGCGGCTGCAGG + Intronic
1152433118 17:80260541-80260563 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433131 17:80260571-80260593 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433144 17:80260601-80260623 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433157 17:80260631-80260653 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433170 17:80260661-80260683 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433183 17:80260691-80260713 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433196 17:80260721-80260743 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433209 17:80260751-80260773 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433222 17:80260781-80260803 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433235 17:80260811-80260833 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152627205 17:81393285-81393307 GGTCCCGGCCCCGCGGGTGCAGG - Intergenic
1152730372 17:81967038-81967060 CTGCCCTGCGCCCCAGCTGCTGG + Intergenic
1152834583 17:82520542-82520564 CTTCCTGGAGCCGGGGCTGCGGG + Intronic
1157294585 18:46433452-46433474 CTTCCAGGAGCTGCTGCTGCAGG - Exonic
1157338167 18:46756514-46756536 CTACCGGGCGCCGCGGGCGCGGG + Exonic
1158183524 18:54745091-54745113 CTTCCAGGAGCTGCGTCTGCTGG + Intronic
1160532934 18:79576137-79576159 CTTCCCGCCGCAGGGGCTGCAGG - Intergenic
1160631110 18:80247055-80247077 CCTCTGAGCGCCGCGGCTGCCGG + Intronic
1160747815 19:720077-720099 CTCCCCCGCGCTGCGGCTGGGGG - Intronic
1160789665 19:917646-917668 CTTCGCGGCGCTGATGCTGCTGG + Exonic
1161101507 19:2424171-2424193 GTTCCCGGCGCCGCAGCCACAGG - Exonic
1161428649 19:4217938-4217960 CTGCCCGGCCCCGCAGCTCCAGG - Exonic
1161973330 19:7595983-7596005 CATGGCGGCGCCGGGGCTGCGGG - Exonic
1163238165 19:16041784-16041806 CTTCCCAGGGCCGCGCCTGTAGG + Intergenic
1163262273 19:16198332-16198354 CTCCCCGGCGCCGGGGCCGGGGG + Intronic
1163711099 19:18847327-18847349 CTTCAGGGCGCTGCTGCTGCAGG + Intronic
1163719809 19:18893771-18893793 CCTCCCAGCACCGCGGCGGCCGG - Intronic
1164813631 19:31177426-31177448 CTTCCCAGCCTCGGGGCTGCTGG + Intergenic
1165242935 19:34481912-34481934 CTTCCCGCCGCCGCTCCGGCCGG - Exonic
1165830676 19:38728831-38728853 CTGCCCGGGGCCAAGGCTGCTGG + Intronic
1166199374 19:41226424-41226446 CTTCAGGGCGCGGAGGCTGCGGG + Intronic
1166393810 19:42424571-42424593 TTTCTCAGCGCCGGGGCTGCTGG - Intronic
1166759790 19:45217573-45217595 CCTGCCGGCCACGCGGCTGCGGG + Exonic
1168412222 19:56147157-56147179 CCTCCCCGCTCTGCGGCTGCCGG - Exonic
926914407 2:17878694-17878716 CTCCTCGCCGCCGCGGCGGCAGG + Intronic
927159223 2:20242390-20242412 CTCCCCTGCGCCGCGGGTCCGGG - Intergenic
927980229 2:27370362-27370384 CTGCCTCGCTCCGCGGCTGCAGG + Intronic
931584273 2:63809182-63809204 CTCCCGGGCGGGGCGGCTGCCGG - Intronic
932410268 2:71543096-71543118 CTTCCAGACGGGGCGGCTGCCGG + Intronic
932624154 2:73284542-73284564 GGTCCCGGCGCAGCCGCTGCTGG - Intergenic
934770824 2:96906794-96906816 GTTCCCGGCCCAGCTGCTGCTGG - Intronic
936037981 2:109128260-109128282 CTTCCCGACGCCCCGGCTTCTGG - Intergenic
936278724 2:111120774-111120796 CCCCTCGGCGCCGCGGCCGCCGG - Intronic
937901737 2:127025100-127025122 CATCCCGGGGTCCCGGCTGCTGG - Intergenic
942681289 2:178480405-178480427 CTCCCCGGCGGCGGGGCTGAAGG - Intergenic
945119652 2:206444042-206444064 CGTCCCGGCCCCGCGCCTGGGGG + Exonic
946422012 2:219570626-219570648 CATCCTGGCGGCTCGGCTGCCGG - Exonic
946688198 2:222292177-222292199 CTTCCCGGCGCAGCAGCTATTGG + Intronic
948197084 2:236104193-236104215 CCTACCAGCGCCCCGGCTGCTGG - Intronic
948868114 2:240785469-240785491 CTTCCCAGAGCCGCGGGTGTGGG - Intronic
1174386454 20:50190742-50190764 CGTCCCGGCGGCGCGGCGGGAGG + Exonic
1175247762 20:57591870-57591892 CCTCCCGGCGCCCCAGCAGCAGG - Intergenic
1176583132 21:8549724-8549746 CTCCCCGCCGCCGCGGCTTTTGG + Intergenic
1180265929 22:10526616-10526638 CTCCCCGCCGCCGCGGCTTTTGG + Intergenic
1181102598 22:20551351-20551373 CTTCCCGCCCCCTCGCCTGCTGG - Intronic
1182050847 22:27311461-27311483 CTTTCCTGCGGTGCGGCTGCCGG - Intergenic
1183201290 22:36387397-36387419 CTTCCGGGAGCCGCGGCCCCTGG - Intronic
1183535486 22:38398461-38398483 TTTCCTCGCGCGGCGGCTGCCGG + Intronic
1183837057 22:40463248-40463270 CTTCCCGGGTCCGGCGCTGCTGG + Exonic
1183942273 22:41302347-41302369 CTTCCCGCGGGCCCGGCTGCAGG - Intronic
1184149592 22:42630516-42630538 CTTCCTGGAGCCTCTGCTGCAGG + Intronic
1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG + Intronic
1185338363 22:50280806-50280828 CATCCCTGAGCCGCGGCGGCCGG - Exonic
950012130 3:9731414-9731436 CCTGCTGGCGCCGCGGCTGCGGG - Intergenic
954886863 3:53882256-53882278 CTGCCCGGCGCAGGGGCTGGGGG + Intergenic
955172991 3:56584167-56584189 CTCCCGGGCGGGGCGGCTGCCGG + Intronic
955626860 3:60927743-60927765 CTCCCAGGCGGGGCGGCTGCCGG - Intronic
955769148 3:62372136-62372158 CTTGCCGGCGCCGCTGGAGCAGG - Exonic
956803855 3:72788474-72788496 CTCCCGGACGCGGCGGCTGCCGG - Intronic
960030108 3:113046738-113046760 CTTCCGGACGGGGCGGCTGCCGG + Intergenic
960120837 3:113947793-113947815 CTTCCCGGCGCCAGGGCCGCGGG + Intergenic
961674301 3:128555496-128555518 CTTCCTGGCGGGGCGGCCGCGGG - Intergenic
962263175 3:133927700-133927722 CTTCCCCGGGCCGCGGCGGAGGG + Intergenic
962431399 3:135323865-135323887 CTTCCAGGCTCAGAGGCTGCTGG - Intergenic
962587963 3:136861539-136861561 CTTCCCCTCGCCGGTGCTGCAGG - Intergenic
965796748 3:172448281-172448303 CTTCCCCGCGCCGCTGCTGGCGG - Exonic
966724696 3:183099185-183099207 CCTCCCGACGCCGTGACTGCCGG + Intronic
967527691 3:190513936-190513958 CTTCCAGGAGCTGCGGCCGCGGG - Intergenic
968083060 3:195860220-195860242 GTGCCCGCCGCCTCGGCTGCAGG + Intergenic
968729112 4:2261505-2261527 CTTCCCGCGGCCGCGCCTCCCGG - Intronic
968879945 4:3293431-3293453 CTGCCCGGCGCCGCCCCCGCGGG - Intronic
968965096 4:3765767-3765789 CTCCCCGGCGCCGCGCGGGCAGG + Intergenic
969331927 4:6478839-6478861 CTTCCCGGGACCCCGGCTGATGG + Intronic
969379111 4:6782810-6782832 CTGCCGGGCGGCGCGGCGGCCGG - Exonic
969578296 4:8049030-8049052 CTTCCTGGAGCTGCGGCTGATGG - Intronic
969599974 4:8170553-8170575 AGTCCCGGCCCCGTGGCTGCGGG - Intergenic
976751907 4:88457508-88457530 CGTCCGGGCGCCGCCGCTCCCGG - Exonic
981993698 4:150954122-150954144 CTCCCCGACGGGGCGGCTGCCGG - Intronic
984811446 4:183798522-183798544 CTTCCCTGGGCGGCGACTGCGGG + Intergenic
984977186 4:185240667-185240689 CTTCCGGACGGGGCGGCTGCCGG + Intronic
986152599 5:5140685-5140707 CTCCCAGGCGCTGCCGCTGCGGG - Exonic
987327329 5:16824297-16824319 CTTCCCGCCCCCGCCACTGCTGG + Intronic
992289644 5:75270420-75270442 CTTCCGGACGGGGCGGCTGCCGG - Intergenic
993168411 5:84384765-84384787 GTTCTCCGCGCGGCGGCTGCGGG + Exonic
996379152 5:122845871-122845893 CTCCCGGGCACGGCGGCTGCGGG + Intronic
997926132 5:138032825-138032847 CTTGCCGTCGCCGCGGGTCCTGG - Exonic
999140461 5:149358108-149358130 CTCCTCGCCGCCGCCGCTGCTGG + Exonic
1002190065 5:177473343-177473365 CTTCCCGGCGGCGGGGCGGCGGG + Intronic
1002441323 5:179265870-179265892 TTTCCCGGGGCCTGGGCTGCAGG + Intronic
1002574072 5:180161660-180161682 CTCCCCAGCCCCGCGGCTCCTGG + Intronic
1002896748 6:1384074-1384096 CTTCCCCGCGCGGCCGCAGCCGG + Intergenic
1004241315 6:13924967-13924989 CTCCCAGGCGCCGCCGCAGCCGG + Exonic
1006096702 6:31660740-31660762 CTTCCGGGCTTCGCGGCTCCCGG - Exonic
1007227132 6:40322844-40322866 CTTCCAGGTGCAGCTGCTGCTGG + Intergenic
1008109584 6:47477985-47478007 CCTCCCGCCGCCGTGGCTCCTGG + Exonic
1008909854 6:56720990-56721012 CTTCCAGACGGGGCGGCTGCCGG + Intronic
1009011988 6:57853953-57853975 CTGCCCGGCTCCAGGGCTGCGGG - Intergenic
1010781175 6:79947422-79947444 CCTCAAGGCGCCGCGGCGGCGGG + Exonic
1012475903 6:99614277-99614299 CCTCCCGCCGCCGCGACGGCCGG - Exonic
1012939654 6:105403131-105403153 CTTGCCGCCGCCGCCGCCGCTGG - Intergenic
1015149338 6:130020214-130020236 CGTCCTCGCGCCGCGGCGGCGGG + Intronic
1018959531 6:168437953-168437975 CTCACCGTCACCGCGGCTGCAGG - Intergenic
1019064202 6:169282208-169282230 CTTCCCTGCACCGGGGATGCTGG - Intergenic
1019293192 7:260443-260465 CTTCCTGGGGCCTCGGCTCCTGG + Exonic
1019982579 7:4632227-4632249 CATCCAGGCGCTGCTGCTGCTGG - Intergenic
1021620817 7:22549869-22549891 ATTCCCGCCCCCGCGGCAGCAGG - Intronic
1022020901 7:26398624-26398646 CCTCCGGCCGCCGCGGCTCCCGG + Intergenic
1032156865 7:129476252-129476274 CTCCCGGGCGGGGCGGCTGCCGG + Intronic
1035229773 7:157458015-157458037 GTTCCCAGCCCCGAGGCTGCAGG + Intergenic
1035264930 7:157685258-157685280 CCTCCCGACGCCGGGGCAGCGGG - Intronic
1039949009 8:42153263-42153285 CTTCCCGGCGCCGCGGCTGCGGG + Intronic
1040355862 8:46617603-46617625 CATGCCGGCGGCGGGGCTGCTGG + Intergenic
1040871023 8:52100449-52100471 CTTCCCGGAGCCGCCTCTGCTGG + Intergenic
1041919832 8:63168976-63168998 CTCCCCGTCGCCGCCGCTGCCGG + Intronic
1047726875 8:127691543-127691565 CTTCCCTGCCCCACAGCTGCAGG + Intergenic
1049649988 8:143761314-143761336 CTTCCCGGGGCCGGAGCAGCAGG - Intergenic
1049680734 8:143916884-143916906 CATCACGGGGCAGCGGCTGCTGG - Exonic
1049684547 8:143934091-143934113 CTTCCCTGTGCTGCTGCTGCAGG - Exonic
1049847124 8:144808268-144808290 CATACCGGTGCCGCGCCTGCGGG + Exonic
1057546257 9:96021882-96021904 GTTCCGAGCGCAGCGGCTGCGGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1058053233 9:100427087-100427109 CTTCCCCGAGCTGCGGCCGCCGG - Intergenic
1060198894 9:121640454-121640476 CTTCCCGGGACAGAGGCTGCAGG + Intronic
1060549380 9:124477820-124477842 CCCGCGGGCGCCGCGGCTGCAGG + Intronic
1061620829 9:131810306-131810328 CATCCCGGCTCCTTGGCTGCAGG - Intergenic
1062551015 9:137086532-137086554 CATCCCCGCGCCGCGGGTTCCGG + Intergenic
1062558818 9:137130070-137130092 CATCCCCGCGCCGCGGGTCCCGG - Intergenic
1203613102 Un_KI270749v1:27529-27551 CTCCCCGCCGCCGCGGCTTTTGG + Intergenic
1186107843 X:6226470-6226492 CTTCCCGGAGCGGCGGGGGCGGG - Intronic
1190746204 X:53323281-53323303 CTTCCAGGAGCCACGTCTGCTGG + Intergenic
1192260807 X:69505007-69505029 CTGCCCGGCGTCCCGGCTGGGGG - Intergenic
1195702621 X:107716472-107716494 TTTCACGGCGCAGCGGCCGCAGG + Intronic
1199230981 X:145436427-145436449 CTCCCCGACGCGGTGGCTGCCGG - Intergenic
1200284281 X:154805491-154805513 CCTCCCGGCGCACCGCCTGCGGG - Exonic
1202584661 Y:26409956-26409978 CTTCCCGCAGCCCCGGCTCCCGG - Intergenic