ID: 1039949028

View in Genome Browser
Species Human (GRCh38)
Location 8:42153357-42153379
Sequence GAAGGGGCACGCGCGTTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 29}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039949028_1039949047 30 Left 1039949028 8:42153357-42153379 CCCCGGAACGCGCGTGCCCCTTC 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1039949047 8:42153410-42153432 GCCTCCGTCGCCGCCGGCTCTGG 0: 1
1: 0
2: 0
3: 42
4: 375
1039949028_1039949045 24 Left 1039949028 8:42153357-42153379 CCCCGGAACGCGCGTGCCCCTTC 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1039949045 8:42153404-42153426 CCCGCGGCCTCCGTCGCCGCCGG 0: 1
1: 0
2: 2
3: 42
4: 287
1039949028_1039949038 8 Left 1039949028 8:42153357-42153379 CCCCGGAACGCGCGTGCCCCTTC 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1039949038 8:42153388-42153410 CCCTGCCCGCCTGCGCCCCGCGG 0: 1
1: 1
2: 1
3: 44
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039949028 Original CRISPR GAAGGGGCACGCGCGTTCCG GGG (reversed) Intronic