ID: 1039953786

View in Genome Browser
Species Human (GRCh38)
Location 8:42191876-42191898
Sequence CCGTGAGGCCCTTTATTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039953778_1039953786 21 Left 1039953778 8:42191832-42191854 CCCGCTGTAGGGTCCTGTGGGAG 0: 1
1: 0
2: 3
3: 18
4: 184
Right 1039953786 8:42191876-42191898 CCGTGAGGCCCTTTATTGCTAGG No data
1039953782_1039953786 8 Left 1039953782 8:42191845-42191867 CCTGTGGGAGAGGTGTGGTTAGT 0: 1
1: 0
2: 0
3: 3
4: 131
Right 1039953786 8:42191876-42191898 CCGTGAGGCCCTTTATTGCTAGG No data
1039953777_1039953786 22 Left 1039953777 8:42191831-42191853 CCCCGCTGTAGGGTCCTGTGGGA 0: 1
1: 0
2: 1
3: 9
4: 132
Right 1039953786 8:42191876-42191898 CCGTGAGGCCCTTTATTGCTAGG No data
1039953779_1039953786 20 Left 1039953779 8:42191833-42191855 CCGCTGTAGGGTCCTGTGGGAGA 0: 1
1: 0
2: 3
3: 12
4: 141
Right 1039953786 8:42191876-42191898 CCGTGAGGCCCTTTATTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039953786 Original CRISPR CCGTGAGGCCCTTTATTGCT AGG Intronic
No off target data available for this crispr