ID: 1039954432

View in Genome Browser
Species Human (GRCh38)
Location 8:42196147-42196169
Sequence CTAGGGGTGGGGGGACCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039954425_1039954432 -9 Left 1039954425 8:42196133-42196155 CCCTTTCTGGATAACTAGGGGTG 0: 1
1: 0
2: 1
3: 9
4: 87
Right 1039954432 8:42196147-42196169 CTAGGGGTGGGGGGACCAGATGG No data
1039954424_1039954432 -8 Left 1039954424 8:42196132-42196154 CCCCTTTCTGGATAACTAGGGGT 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1039954432 8:42196147-42196169 CTAGGGGTGGGGGGACCAGATGG No data
1039954418_1039954432 4 Left 1039954418 8:42196120-42196142 CCTGGGAACATCCCCCTTTCTGG 0: 1
1: 0
2: 4
3: 14
4: 170
Right 1039954432 8:42196147-42196169 CTAGGGGTGGGGGGACCAGATGG No data
1039954426_1039954432 -10 Left 1039954426 8:42196134-42196156 CCTTTCTGGATAACTAGGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1039954432 8:42196147-42196169 CTAGGGGTGGGGGGACCAGATGG No data
1039954422_1039954432 -7 Left 1039954422 8:42196131-42196153 CCCCCTTTCTGGATAACTAGGGG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1039954432 8:42196147-42196169 CTAGGGGTGGGGGGACCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039954432 Original CRISPR CTAGGGGTGGGGGGACCAGA TGG Intronic
No off target data available for this crispr