ID: 1039956268

View in Genome Browser
Species Human (GRCh38)
Location 8:42209355-42209377
Sequence GAAAATGCACATATACACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039956265_1039956268 9 Left 1039956265 8:42209323-42209345 CCTAAGTGTCCATCAATGGAGGA No data
Right 1039956268 8:42209355-42209377 GAAAATGCACATATACACCGAGG No data
1039956267_1039956268 0 Left 1039956267 8:42209332-42209354 CCATCAATGGAGGACTGGATAAA No data
Right 1039956268 8:42209355-42209377 GAAAATGCACATATACACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039956268 Original CRISPR GAAAATGCACATATACACCG AGG Intergenic
No off target data available for this crispr