ID: 1039961903

View in Genome Browser
Species Human (GRCh38)
Location 8:42254832-42254854
Sequence CTGTGGGGCGGCCGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039961903_1039961917 22 Left 1039961903 8:42254832-42254854 CCCTCTGCCCGGCCGCCCCACAG No data
Right 1039961917 8:42254877-42254899 TGTCCGGCTGCCCACTGTCTGGG No data
1039961903_1039961916 21 Left 1039961903 8:42254832-42254854 CCCTCTGCCCGGCCGCCCCACAG No data
Right 1039961916 8:42254876-42254898 CTGTCCGGCTGCCCACTGTCTGG No data
1039961903_1039961914 6 Left 1039961903 8:42254832-42254854 CCCTCTGCCCGGCCGCCCCACAG No data
Right 1039961914 8:42254861-42254883 AAGTGAGGAGTGCCTCTGTCCGG No data
1039961903_1039961919 30 Left 1039961903 8:42254832-42254854 CCCTCTGCCCGGCCGCCCCACAG No data
Right 1039961919 8:42254885-42254907 TGCCCACTGTCTGGGAAGTGAGG 0: 14
1: 23
2: 106
3: 449
4: 2251
1039961903_1039961910 -9 Left 1039961903 8:42254832-42254854 CCCTCTGCCCGGCCGCCCCACAG No data
Right 1039961910 8:42254846-42254868 GCCCCACAGTCTGGGAAGTGAGG 0: 3
1: 37
2: 372
3: 3295
4: 7821

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039961903 Original CRISPR CTGTGGGGCGGCCGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr