ID: 1039965887

View in Genome Browser
Species Human (GRCh38)
Location 8:42283458-42283480
Sequence TCCCACGTTTAAGAACCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039965887_1039965895 25 Left 1039965887 8:42283458-42283480 CCCAAGGGTTCTTAAACGTGGGA No data
Right 1039965895 8:42283506-42283528 GCCGATGCATGTGAGGAAGATGG No data
1039965887_1039965892 -1 Left 1039965887 8:42283458-42283480 CCCAAGGGTTCTTAAACGTGGGA No data
Right 1039965892 8:42283480-42283502 AGAAGGAGGCAGCAGAGCCAGGG No data
1039965887_1039965897 28 Left 1039965887 8:42283458-42283480 CCCAAGGGTTCTTAAACGTGGGA No data
Right 1039965897 8:42283509-42283531 GATGCATGTGAGGAAGATGGCGG No data
1039965887_1039965891 -2 Left 1039965887 8:42283458-42283480 CCCAAGGGTTCTTAAACGTGGGA No data
Right 1039965891 8:42283479-42283501 GAGAAGGAGGCAGCAGAGCCAGG No data
1039965887_1039965898 29 Left 1039965887 8:42283458-42283480 CCCAAGGGTTCTTAAACGTGGGA No data
Right 1039965898 8:42283510-42283532 ATGCATGTGAGGAAGATGGCGGG No data
1039965887_1039965894 18 Left 1039965887 8:42283458-42283480 CCCAAGGGTTCTTAAACGTGGGA No data
Right 1039965894 8:42283499-42283521 AGGGTCAGCCGATGCATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039965887 Original CRISPR TCCCACGTTTAAGAACCCTT GGG (reversed) Intronic