ID: 1039967906

View in Genome Browser
Species Human (GRCh38)
Location 8:42297100-42297122
Sequence GATGTGAACAGGTCTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039967906_1039967914 9 Left 1039967906 8:42297100-42297122 CCTTCCTCAGACCTGTTCACATC 0: 1
1: 0
2: 2
3: 18
4: 242
Right 1039967914 8:42297132-42297154 TTTTGGGTGCAGTGCAGCCCCGG No data
1039967906_1039967909 -8 Left 1039967906 8:42297100-42297122 CCTTCCTCAGACCTGTTCACATC 0: 1
1: 0
2: 2
3: 18
4: 242
Right 1039967909 8:42297115-42297137 TTCACATCTCCGCCACCTTTTGG No data
1039967906_1039967910 -7 Left 1039967906 8:42297100-42297122 CCTTCCTCAGACCTGTTCACATC 0: 1
1: 0
2: 2
3: 18
4: 242
Right 1039967910 8:42297116-42297138 TCACATCTCCGCCACCTTTTGGG No data
1039967906_1039967915 23 Left 1039967906 8:42297100-42297122 CCTTCCTCAGACCTGTTCACATC 0: 1
1: 0
2: 2
3: 18
4: 242
Right 1039967915 8:42297146-42297168 CAGCCCCGGTTTTGTTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039967906 Original CRISPR GATGTGAACAGGTCTGAGGA AGG (reversed) Intronic
900425192 1:2575122-2575144 GATGTGGCCAGGGCTGGGGAGGG + Intergenic
900743802 1:4346507-4346529 GGGGTGGACAGGGCTGAGGAAGG + Intergenic
902279066 1:15361248-15361270 AATGTCAACAGGGCTGAGGCTGG - Intronic
902389813 1:16096664-16096686 GCTGTGAACAGGACAGAGGCTGG - Intergenic
903604845 1:24568051-24568073 GATGTGAACGGGTCACAGGCGGG - Intronic
905890429 1:41515431-41515453 GATGAGAGCAGGGCTGGGGATGG + Intronic
906714052 1:47953885-47953907 CATGTGAACAGCTATGAGGGAGG - Intronic
907127884 1:52067774-52067796 AATGTCAACAGGGCTGAGGTTGG - Intronic
907757677 1:57326785-57326807 GATTCGATGAGGTCTGAGGATGG - Intronic
908662014 1:66446917-66446939 GATGTGGACATTTCTGGGGAAGG + Intergenic
909702208 1:78538426-78538448 GATGTGTACATATCTTAGGAGGG + Exonic
910878099 1:91896567-91896589 TATGTGAACAGGTCTGACTATGG - Intronic
911869606 1:103078669-103078691 GATGTTAACAGTTCTGAAGAGGG + Exonic
912097147 1:106159726-106159748 GATCTCAACACGTCTGAGGGTGG - Intergenic
914400562 1:147316396-147316418 AATCTGCACAGGTCTGAGGTTGG - Intergenic
915532401 1:156510273-156510295 GAAGTGTAAAGGTCTGAGGGCGG + Intergenic
915580124 1:156808538-156808560 GATGGGGAAGGGTCTGAGGAGGG + Intronic
915632421 1:157162783-157162805 GAAGTAAACAGGATTGAGGAGGG - Intergenic
915735496 1:158082074-158082096 GATGGGGACAGGTTTGAGGATGG - Intronic
916894807 1:169151438-169151460 GTTCTGTAGAGGTCTGAGGATGG - Intronic
917707084 1:177645676-177645698 GAGATGAACAGGTCTGCGGGAGG - Intergenic
918070816 1:181132189-181132211 GAGGTGAACAGGTGGGTGGAGGG - Intergenic
918420110 1:184355632-184355654 GATATGAACAGTCCTAAGGAGGG - Intergenic
918429807 1:184447934-184447956 GCTGTAAATAGGTCTGAGGACGG - Intronic
921302896 1:213767433-213767455 GATTTGCATAGGTCAGAGGAGGG - Intergenic
921950004 1:220919591-220919613 AATGTAAACAGCTCTGGGGAGGG + Intergenic
922007374 1:221545606-221545628 GATGAGAACGGGTCTTAGCAAGG - Intergenic
923119290 1:230976130-230976152 GATATGAACAGGTTTGTGGCTGG + Intronic
923638271 1:235723385-235723407 GAAGAGAAGAGGTCTGAGGAAGG + Intronic
923836188 1:237614029-237614051 GATGTCAACAGATCTGTAGAAGG - Exonic
1063035262 10:2280513-2280535 GGTCTGACCAGCTCTGAGGAAGG + Intergenic
1063351733 10:5362818-5362840 AATGTCAACAGTGCTGAGGATGG + Intergenic
1063821587 10:9842568-9842590 AATGTCAACAGTTCTGAGGCTGG + Intergenic
1064026668 10:11854090-11854112 GAGGAGAACAGGTCTAAGGCTGG - Intronic
1065299605 10:24309263-24309285 GATGTGATATGGTATGAGGATGG + Intronic
1067741629 10:48899906-48899928 GAAGTGAAAAAGTCTGAGGATGG + Intronic
1068436122 10:56993392-56993414 GAAATGAACAGGACTGAGTAGGG + Intergenic
1068706518 10:60082245-60082267 GATATGAAAAGGACTGAGTAGGG + Intronic
1070248168 10:74751059-74751081 GATGTGGAGAGGGCTGAGGGTGG - Intergenic
1070484007 10:76912476-76912498 GAGGTGAAATGGTCTGAGGAGGG + Intronic
1070666640 10:78349720-78349742 GATGTGAACAGTGCTGGGGTTGG + Intergenic
1071308580 10:84322318-84322340 GATGAGAACAGTTCTGGAGATGG + Intergenic
1071747475 10:88438168-88438190 GATATGACAAAGTCTGAGGAAGG - Intronic
1072605768 10:96981358-96981380 AATGTGAACATATGTGAGGATGG + Exonic
1075535667 10:123270100-123270122 AATGTGTACAGGGCTGAGCATGG + Intergenic
1076107375 10:127834433-127834455 GATGTGAGCATGGGTGAGGACGG - Intergenic
1076295746 10:129382885-129382907 CATGTGATCAGGTCTTAGAATGG - Intergenic
1076364242 10:129911611-129911633 GATGGGAAGAGGGGTGAGGAGGG + Intronic
1076662474 10:132064819-132064841 GATGATAACATGTCAGAGGATGG - Intergenic
1076807091 10:132864285-132864307 GGTGTGTACAGGTCTCAGGCAGG - Intronic
1076807127 10:132864463-132864485 GATGTGTGCAGGTCTCAGGCAGG - Intronic
1076883509 10:133251126-133251148 GCTGCGCACAGGTGTGAGGACGG - Intergenic
1077763707 11:5133693-5133715 GATGTGCACATGGCTGAGCATGG - Intergenic
1079359295 11:19757113-19757135 GATGGGAAAAGGTCAGAGCAGGG - Intronic
1080255857 11:30289601-30289623 GATGTGGACAGGTCTGAGGTGGG - Intergenic
1081016119 11:37883085-37883107 GATAAGAACAGGACTGAGAAAGG + Intergenic
1081016341 11:37886145-37886167 GATAAGAACAGGACTGAGAAAGG + Intergenic
1081484988 11:43520644-43520666 GATGTGAAAAGGTGAGAGCAGGG - Intergenic
1082348680 11:51473053-51473075 GAGGTGAACAATTCTGATGATGG + Intergenic
1083058063 11:59842309-59842331 GATGTGAACGTGCCTGTGGATGG - Intronic
1084413697 11:69018219-69018241 GAGGTGGACAGGGCAGAGGAGGG - Intergenic
1085242598 11:75071220-75071242 GTTGAGAACAGGTGTGAGAATGG + Intergenic
1087396673 11:97609444-97609466 CATGTGCACAGGCCTGAGGGTGG + Intergenic
1094359366 12:29613384-29613406 GCTGGGAACCTGTCTGAGGAGGG + Intronic
1095334162 12:41006749-41006771 AATGTTAACAGATTTGAGGATGG + Intronic
1095515249 12:42998551-42998573 TTTGTGAATAGGTTTGAGGAAGG + Intergenic
1096976358 12:55701142-55701164 GGTGTGCACAGGTCTGGGGGAGG + Exonic
1098877987 12:75886890-75886912 GACTTGGAAAGGTCTGAGGATGG - Intergenic
1101140401 12:101789873-101789895 GATGTAATAAGGTCTGAGGGTGG - Intronic
1101564984 12:105896605-105896627 GATCTGAACAGGTCTGGGTGTGG - Intergenic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1101971711 12:109318789-109318811 GAAGAGAACATTTCTGAGGAAGG + Intergenic
1102516117 12:113448007-113448029 GCTGAGAACAGGGCTGAGGGAGG - Intergenic
1103254607 12:119530291-119530313 GATGTGATCAGGTTTAAGGCTGG - Intronic
1103300998 12:119926616-119926638 GAGGTGACTAGGTCAGAGGATGG + Intergenic
1103830798 12:123777436-123777458 CATGTGAGCAGTTCTGGGGATGG + Intronic
1104232407 12:126898055-126898077 CATGAGAACAAGTCAGAGGAAGG + Intergenic
1104856708 12:131905558-131905580 GATGTGTACAGGGCAGAGGGAGG + Intronic
1105639099 13:22244128-22244150 GTTGTGAACAGGTTTAAAGAGGG + Intergenic
1108616256 13:52135553-52135575 GATGAGAACATTTCTGTGGATGG + Intronic
1109006152 13:56880638-56880660 GATGGTAACAGCTATGAGGAAGG + Intergenic
1109726110 13:66343832-66343854 GATTTGGAAAGGGCTGAGGATGG + Intronic
1112944616 13:104912719-104912741 GATAGGAACAGGTCGGAAGATGG - Intergenic
1114712645 14:24794153-24794175 GATGTGAAAAGGAGTGAGAATGG - Intergenic
1115262387 14:31467299-31467321 GAAATGAACAGGGCAGAGGAGGG - Intergenic
1117742022 14:58828370-58828392 GATGTGAACGGGACTGAGTCAGG - Intergenic
1120949304 14:90026407-90026429 GATGTGGACAGGTGAGAGGAAGG - Intronic
1121908375 14:97767672-97767694 CATGGGCACAGGCCTGAGGAAGG + Intergenic
1122278126 14:100605576-100605598 GGTGGGAGCAGGTTTGAGGAGGG + Intergenic
1122587993 14:102824312-102824334 GATGTGATCTGGTCTTAGGAAGG - Intronic
1125100074 15:35902354-35902376 GTTGTGATCAGGTATGGGGAAGG + Intergenic
1125532291 15:40421612-40421634 GATGTGATTAGGTCTGGGGCAGG - Intronic
1127386136 15:58468712-58468734 GATCTGAACTGGTCTGGGGTGGG - Intronic
1129460511 15:75698075-75698097 GCTGTGCACAGGAGTGAGGAGGG + Intronic
1129724352 15:77893961-77893983 GCTGTGCACAGGAGTGAGGAGGG - Intergenic
1129986245 15:79922580-79922602 TGTGTGAAGAGGTCAGAGGATGG - Intronic
1131293772 15:91129697-91129719 GATGTGATACGGTCTGTGGATGG + Intronic
1133503498 16:6387804-6387826 GAAGTCAAAAGGTCTGAGAATGG - Intronic
1133658283 16:7888534-7888556 AATGTGATCAGGTCTGAGGGAGG - Intergenic
1135428730 16:22363509-22363531 GATGTGATCACTTCTAAGGAAGG + Intronic
1135491837 16:22916041-22916063 GAATTGATAAGGTCTGAGGAGGG - Exonic
1135617580 16:23925279-23925301 GATGTTATCAGGGCAGAGGATGG - Intronic
1136173482 16:28502405-28502427 GAAGGGAACAGGGCTGTGGATGG - Intronic
1136580292 16:31147468-31147490 GATGGGCACAGGTCTGACCACGG + Intronic
1137398065 16:48131151-48131173 GAAGGGAAAAGGTCTGAGGCAGG + Intronic
1138092879 16:54190990-54191012 AATGTCATCAGGGCTGAGGAAGG + Intergenic
1139991739 16:70945143-70945165 GATGGCAACAGGGATGAGGATGG + Intronic
1143145893 17:4775150-4775172 AATGAGATGAGGTCTGAGGAGGG + Intronic
1143530556 17:7500745-7500767 GATGTGACCAGGTATGATGAGGG - Exonic
1145176733 17:20707232-20707254 GATGAGAACACGTGTGTGGAGGG + Intergenic
1146060433 17:29602755-29602777 GATGTGGACATGTCTTAGGAGGG + Intronic
1147250560 17:39150734-39150756 AATGGGAGCAGGTGTGAGGAGGG + Intronic
1147898287 17:43766870-43766892 AAAGGGAACAGGTCTGGGGAGGG + Exonic
1153169598 18:2300904-2300926 GATGTGAGCATCTTTGAGGAGGG - Intergenic
1157733496 18:50025358-50025380 GTTGTGAACTGGTTGGAGGAAGG - Intronic
1158918712 18:62165207-62165229 GATGTGAGCATGTGTGAAGAGGG - Intronic
1159669834 18:71209757-71209779 GGTGTGCATAGGACTGAGGAAGG - Intergenic
1160820890 19:1057241-1057263 GGTGGGAACAGGGCTGAGGGTGG + Intronic
1161621273 19:5298625-5298647 GATGTGAACATGGGTGAGGCGGG - Intronic
1162801371 19:13112605-13112627 AAGCTGAGCAGGTCTGAGGAGGG + Intronic
1163528664 19:17836757-17836779 GGTGTGATGAGGTGTGAGGAGGG - Intronic
1163874263 19:19853496-19853518 AATCTGAACAGGTCTGGGGCAGG + Intergenic
1163924476 19:20326660-20326682 AATCTGAACAGGTCTGGGGCAGG - Intergenic
1163970510 19:20789263-20789285 AATCTGAACAGGTCTGAGGCAGG - Intronic
1164228087 19:23263729-23263751 TATGTGGACAGGGCTGAGGCAGG + Intergenic
1165365089 19:35360299-35360321 GCTGGGAGCAGCTCTGAGGATGG - Exonic
1165366907 19:35372767-35372789 GCTGGGAGCAGCTCTGAGGATGG - Intronic
1166428529 19:42701472-42701494 GATATGAAGAAGTCTGAGGCTGG + Intronic
1166674026 19:44728327-44728349 GGTGAGAACAGGACTGGGGAGGG - Intergenic
1167105289 19:47426855-47426877 GATGAGAACAGGTTTGTGGAAGG - Intergenic
1167622177 19:50566526-50566548 GAGGTGAGGAGGTCTGGGGAAGG + Intronic
926111200 2:10184909-10184931 GAAGAGCACAGGTCTGAAGATGG + Intronic
928283208 2:29966592-29966614 AATGTGAACTGGGCTGAGCAGGG - Intergenic
931962289 2:67495284-67495306 GATGTAAAGAGGTGAGAGGAAGG + Intergenic
932770845 2:74499964-74499986 GATTTGCAAAGTTCTGAGGAAGG + Intronic
932773039 2:74512377-74512399 GCTGTTAGCAGGGCTGAGGAGGG + Intergenic
932823599 2:74921378-74921400 GATGGGAACCGGTGGGAGGATGG - Intergenic
933785525 2:85838220-85838242 GATGGGAGCAGGCCTGAGAATGG + Intergenic
936039580 2:109140061-109140083 GAAGAGGACAGGTCTGCGGAAGG + Intronic
936237427 2:110755166-110755188 GATGTGATGAGGTCTAGGGAGGG - Intronic
937317791 2:120943143-120943165 GACGTGCTCAGGTCAGAGGAAGG + Intronic
937760025 2:125589997-125590019 GATGTTAACAGAAGTGAGGAGGG - Intergenic
937858500 2:126690145-126690167 GGTGTGAGCAGCTCTGAGAATGG - Intronic
937859001 2:126693754-126693776 GGTGTGAGCAGCTCTGAGAATGG - Intronic
938405690 2:131031973-131031995 GATGTGACCAGGGGAGAGGACGG + Intronic
940055422 2:149507921-149507943 GTTGGGAACAGGGGTGAGGAGGG - Intergenic
942848163 2:180451069-180451091 TATTTGAACAGGGCTGAGGCTGG - Intergenic
945200111 2:207272660-207272682 GATAAGAGCAGGTCTGAGTAAGG + Intergenic
945273441 2:207964313-207964335 GATTTCAACAGGTCTGGGGAAGG + Intronic
947574409 2:231261235-231261257 GGTGTGTACAGGTGTGAGGTGGG - Intronic
947648170 2:231760445-231760467 AATCTGTACAGGTTTGAGGATGG + Intronic
948292295 2:236834807-236834829 GATTTGGAGAGGTCTGTGGATGG - Intergenic
1169900459 20:10547425-10547447 GAGGTGAAAAGGACTCAGGAGGG - Intronic
1170128440 20:12991328-12991350 CATGTGAACAGGGTTAAGGATGG + Intergenic
1170460249 20:16571142-16571164 GAGGTGAACAGGTTTGAGGAAGG - Intronic
1173498562 20:43536024-43536046 GCTGGGACCAGGGCTGAGGAGGG + Intronic
1173885765 20:46457655-46457677 GAGGTGAGCTGGGCTGAGGATGG - Intergenic
1174324899 20:49771373-49771395 TAGGGGAACAGGTTTGAGGAGGG - Intergenic
1174443725 20:50576470-50576492 GAGGTGAGCAGGTGTGAGGGAGG + Intronic
1174775141 20:53336528-53336550 GATATTAAGATGTCTGAGGATGG + Intronic
1175077838 20:56391195-56391217 GACATGCACAGGTCTGAGGGAGG - Intronic
1175523356 20:59617219-59617241 CATGGGAATAGGTATGAGGAGGG - Intronic
1176412211 21:6455190-6455212 GTTAAGAGCAGGTCTGAGGACGG - Intergenic
1177177070 21:17711786-17711808 GATGAGAACTGGTTGGAGGAAGG + Intergenic
1178260713 21:31097580-31097602 GATGTGATGAAGCCTGAGGATGG - Intergenic
1178274338 21:31223146-31223168 CATGTGAACAGCGCTGAAGATGG + Intronic
1179398190 21:41060280-41060302 GAAGAGGAGAGGTCTGAGGACGG - Intergenic
1179656612 21:42849924-42849946 GTTGTGACCAGCTCAGAGGATGG - Exonic
1179687705 21:43063512-43063534 GTTAAGAGCAGGTCTGAGGACGG - Intronic
1180033097 21:45225579-45225601 ATTGTGCACAGATCTGAGGATGG + Exonic
1181048845 22:20229233-20229255 CATGTGCACAGGACAGAGGAGGG - Intergenic
1181475518 22:23165497-23165519 GAACTGAACAGGTCTCGGGAAGG + Intergenic
1182647425 22:31821643-31821665 GATGTGCACAGGGCTCTGGAAGG + Intronic
1182765504 22:32755082-32755104 GCTGGGAACTGGTCTGGGGAAGG + Intronic
1182940985 22:34277296-34277318 GATGTGAACAGGCCATAGGGAGG - Intergenic
1183297207 22:37037396-37037418 CATGAGTACAGGGCTGAGGAAGG - Intergenic
1183335266 22:37242700-37242722 GAAGTGAACAGGGCTGGGGCAGG + Intronic
1184159552 22:42689846-42689868 GATGTGAACAGGAGTGATGCGGG - Intergenic
1184438656 22:44495845-44495867 GATGGGAACAGGTCTCAAGCTGG + Exonic
1184784490 22:46665155-46665177 GATGTGCACAGGGCAGGGGATGG - Intronic
1185414769 22:50704012-50704034 GGTATGAAGAGGTCAGAGGAGGG + Intergenic
953957850 3:47245354-47245376 GCTCTGCAAAGGTCTGAGGATGG + Intronic
954872817 3:53780676-53780698 GATTTGACCAGGGCTGAGCATGG - Intronic
955573287 3:60330914-60330936 GATGTGAACAAGACTGTGGTTGG - Intronic
956116060 3:65920128-65920150 GATGTGAACAGGACTGTTGTGGG - Intronic
956881135 3:73511591-73511613 GAGGGGAACAGATCTGGGGATGG + Intronic
959413892 3:106061002-106061024 GATGAAACCAGGTATGAGGAAGG - Intergenic
961658426 3:128455902-128455924 GATGTGCCCAGGTCAGAAGATGG + Intergenic
962440553 3:135411268-135411290 GATGTGAGCAACTATGAGGATGG - Intergenic
962677636 3:137768517-137768539 GTTGGGACCAGGTCTAAGGAGGG - Intergenic
963736092 3:149019392-149019414 GAGGTGAGCAGGACTGTGGAGGG - Intronic
963767554 3:149353337-149353359 AATGTGGGCAGGTCTGAGGGTGG - Intergenic
966983352 3:185157660-185157682 CATGTGTACAAGTCTGAGCAAGG + Intergenic
967469780 3:189848283-189848305 GGAGTGCACTGGTCTGAGGATGG + Intronic
969495851 4:7525792-7525814 GCAGGGAACAGGTATGAGGAGGG - Intronic
970175909 4:13339336-13339358 GGTGGGAAAAGGTCTGTGGAAGG - Intergenic
974673524 4:65061762-65061784 AATGTGAACTGCTCTGAAGAGGG + Intergenic
976361546 4:84184313-84184335 GATGTGAATTGGTCTGAGTAGGG + Intergenic
977968438 4:103184178-103184200 TTTGTTCACAGGTCTGAGGATGG + Intronic
982297929 4:153849050-153849072 GATGAGAACAAGTCTAAGAAGGG - Intergenic
982780353 4:159483928-159483950 GATGTGAGCATTTCTGAGGCTGG - Intergenic
985298257 4:188458336-188458358 AATGTGAACAGCTAGGAGGAAGG + Intergenic
992324782 5:75650113-75650135 GATGTGAACATCTCTGGGGTGGG - Intronic
992679223 5:79136456-79136478 GATGTAAACAATTTTGAGGAAGG - Intronic
993568271 5:89502759-89502781 CATGAGAAGAGGGCTGAGGATGG + Intergenic
993904381 5:93606397-93606419 TATGTGTAAAGATCTGAGGATGG - Intergenic
995183967 5:109252756-109252778 GATAGGAACTGGCCTGAGGAAGG - Intergenic
998195291 5:140064298-140064320 GATGCTATCAGTTCTGAGGATGG + Intergenic
999006671 5:147987580-147987602 GTTGTGCACAGGTCAGAAGAAGG - Intergenic
999519570 5:152337355-152337377 GATGTTGACAGGGCTGTGGAAGG + Intergenic
1000364257 5:160476483-160476505 GATGGGAAGATGACTGAGGACGG + Intergenic
1001704800 5:173734064-173734086 GCTGTGAACAAGTGTGAGGGTGG + Intergenic
1001893382 5:175358293-175358315 GAGGTGAGCAGGTCAGAGCATGG - Intergenic
1002323964 5:178393430-178393452 GATGTAAACAGTTCTGATGATGG + Intronic
1003561757 6:7186310-7186332 TATGTGCCCAGGTTTGAGGATGG - Intronic
1004803104 6:19172799-19172821 GCAGTGAATAGCTCTGAGGATGG - Intergenic
1005355447 6:24978899-24978921 GATGTGAAAAGGTCCCAGAATGG + Intronic
1006371550 6:33647451-33647473 GATGAAAAAAGGTCTGTGGATGG - Intronic
1006853550 6:37116886-37116908 GATGTGCAGGGGCCTGAGGAGGG - Intergenic
1008766900 6:54928287-54928309 GATGTGAACACGACTGTGTAAGG + Intronic
1012180397 6:96145700-96145722 GATGTGCAAAGGCCTGAGGCAGG + Intronic
1012934740 6:105355042-105355064 AACATGAACAGGTCTGAGTAAGG + Intronic
1013067034 6:106694003-106694025 GCTGTAAACAGGTTTGAGAACGG - Intergenic
1015852658 6:137589679-137589701 GATGTGCACAGTGCTAAGGAAGG + Intergenic
1017183508 6:151577136-151577158 AATGTCAATAGTTCTGAGGATGG - Intronic
1017731175 6:157317494-157317516 AAAGAGAAGAGGTCTGAGGAAGG - Intronic
1019644597 7:2122237-2122259 GAGGTGGACAGGTCTGACGCGGG - Intronic
1023027622 7:36065130-36065152 GAAGTGGACTGGTCTGAGGTGGG + Intergenic
1027254939 7:76425226-76425248 GATGTGGTCAGGTTTGAGGTTGG + Exonic
1027412114 7:77931433-77931455 GATGTGAACAGGTCCCCTGATGG + Intronic
1032697893 7:134353491-134353513 GGTCTCAACAGGTCTGAAGATGG - Intergenic
1033609446 7:142951998-142952020 GATGTGGATATATCTGAGGAGGG - Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034460578 7:151195838-151195860 GGTGTGAACAGGTGCCAGGAGGG - Intronic
1034696812 7:153060998-153061020 GATGTGAGAAGGCCTAAGGAGGG - Intergenic
1035786053 8:2262075-2262097 TATGTGATCAGGTGTGAGGCAGG - Intergenic
1035806754 8:2459641-2459663 TATGTGATCAGGTGTGAGGCAGG + Intergenic
1037864914 8:22435920-22435942 GATGTGAACAGCAAGGAGGAAGG - Intergenic
1039967906 8:42297100-42297122 GATGTGAACAGGTCTGAGGAAGG - Intronic
1039997833 8:42549626-42549648 GATGAGAAGAGCTCTGTGGATGG + Intronic
1041378612 8:57227713-57227735 GATGTGAACAGGAGACAGGAGGG + Intergenic
1045179431 8:99764243-99764265 GCAGTGATCAGTTCTGAGGATGG + Intronic
1047681490 8:127258372-127258394 GAGGTGAGGAGGTCTGAGAAGGG + Intergenic
1048506546 8:135026999-135027021 AATGTGAATAGGTCTGAATAGGG - Intergenic
1051359696 9:16270933-16270955 GAGGTGATTAGGTCTGAGCAGGG + Intronic
1053363913 9:37509388-37509410 GATGTGGAGAGGTGTGAGGAGGG - Intergenic
1053654675 9:40204694-40204716 GATTTGAACAGCTTTGAAGAAGG + Intergenic
1054366790 9:64350911-64350933 GATTTGAACAGCTTTGAAGAAGG + Intergenic
1054674419 9:67840653-67840675 GATTTGAACAGCTTTGAAGAAGG + Intergenic
1059248369 9:112867053-112867075 GGTGGGAATAGTTCTGAGGAGGG - Intronic
1059248437 9:112867332-112867354 GGTGGGAAGAGTTCTGAGGAGGG - Intronic
1059248446 9:112867372-112867394 GGTGGGAAGAGTTCTGAGGAGGG - Intronic
1060732068 9:126044995-126045017 AATGTGAAAAGTTCTGAGAAGGG - Intergenic
1061759496 9:132840452-132840474 CAAGTGAACAGGCATGAGGAAGG + Intronic
1185529135 X:803252-803274 GATATGAATAGGGCTGAGAACGG + Intergenic
1189978581 X:46486974-46486996 GATCTCACCACGTCTGAGGACGG + Intronic
1190343594 X:49317267-49317289 GAGGTGAAAAGGCCTGAAGAAGG + Exonic
1196790251 X:119458141-119458163 GATGTGAGGAAGACTGAGGAGGG + Intergenic
1196972091 X:121120739-121120761 GATGTAAGCAGTTCTGTGGATGG - Intergenic
1197754587 X:129984549-129984571 GAGGTGAACTGGTCGGTGGAGGG + Intronic
1199656432 X:149999616-149999638 GTGCTGAACAGGTCAGAGGAAGG - Intergenic
1199973631 X:152878350-152878372 GCTGAGAACAGGAGTGAGGAAGG + Intergenic
1202086097 Y:21138423-21138445 AATATGCACAGGGCTGAGGATGG + Intergenic