ID: 1039974312

View in Genome Browser
Species Human (GRCh38)
Location 8:42347916-42347938
Sequence TGCTGAATGTTTAACTAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039974309_1039974312 20 Left 1039974309 8:42347873-42347895 CCTGAGAGGCAGTAGAGATAACT 0: 1
1: 0
2: 0
3: 25
4: 155
Right 1039974312 8:42347916-42347938 TGCTGAATGTTTAACTAAAAAGG No data
1039974308_1039974312 26 Left 1039974308 8:42347867-42347889 CCTAGGCCTGAGAGGCAGTAGAG 0: 1
1: 0
2: 1
3: 37
4: 280
Right 1039974312 8:42347916-42347938 TGCTGAATGTTTAACTAAAAAGG No data
1039974311_1039974312 -9 Left 1039974311 8:42347902-42347924 CCTGTTATTAAGCATGCTGAATG 0: 1
1: 0
2: 1
3: 9
4: 111
Right 1039974312 8:42347916-42347938 TGCTGAATGTTTAACTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039974312 Original CRISPR TGCTGAATGTTTAACTAAAA AGG Intronic
No off target data available for this crispr