ID: 1039976508

View in Genome Browser
Species Human (GRCh38)
Location 8:42371049-42371071
Sequence TCAGTGCCACAAAGGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039976508_1039976515 26 Left 1039976508 8:42371049-42371071 CCAGGTTCCCTTTGTGGCACTGA 0: 1
1: 0
2: 0
3: 16
4: 203
Right 1039976515 8:42371098-42371120 AGCCTCCTGGGAGAGGATAGAGG No data
1039976508_1039976512 14 Left 1039976508 8:42371049-42371071 CCAGGTTCCCTTTGTGGCACTGA 0: 1
1: 0
2: 0
3: 16
4: 203
Right 1039976512 8:42371086-42371108 AAGCTCCAGCACAGCCTCCTGGG No data
1039976508_1039976514 19 Left 1039976508 8:42371049-42371071 CCAGGTTCCCTTTGTGGCACTGA 0: 1
1: 0
2: 0
3: 16
4: 203
Right 1039976514 8:42371091-42371113 CCAGCACAGCCTCCTGGGAGAGG No data
1039976508_1039976511 13 Left 1039976508 8:42371049-42371071 CCAGGTTCCCTTTGTGGCACTGA 0: 1
1: 0
2: 0
3: 16
4: 203
Right 1039976511 8:42371085-42371107 GAAGCTCCAGCACAGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039976508 Original CRISPR TCAGTGCCACAAAGGGAACC TGG (reversed) Intronic
901166146 1:7222933-7222955 TCTGTGCCACACAGGGTGCCGGG - Intronic
903050220 1:20595017-20595039 ACAGTGCCAGAAAGGGTCCCAGG + Intronic
906415154 1:45616070-45616092 TCTGTGCCAAAAACAGAACCAGG - Intronic
907158893 1:52357346-52357368 TCACGGCCCCAAAGGAAACCAGG - Intronic
907697173 1:56743477-56743499 TCAGTGAAACAAAGGTACCCAGG + Intronic
909074579 1:71037796-71037818 TGAGTGCCACAGAGAGAACAAGG - Intronic
910250691 1:85195637-85195659 TCAGTTCCACAAAAGTAACAGGG + Intronic
911362999 1:96902205-96902227 TCAGTGCCACAAAGAAGAACCGG - Intergenic
917682847 1:177385140-177385162 TCAGTGCCAGTGAGAGAACCTGG + Intergenic
918096385 1:181338378-181338400 TCAAAACCACAAAGGGGACCAGG - Intergenic
1063744304 10:8862394-8862416 GCAGTGTGACAAAGGGAAACAGG + Intergenic
1063947930 10:11195531-11195553 GCAGTGTCACTAAGGGAAACAGG + Intronic
1064391392 10:14945449-14945471 TCAGTGCCACCAAGAGCACAAGG + Intronic
1066642024 10:37563574-37563596 TGAATGCCACAAAGGCAACCTGG + Intergenic
1069026045 10:63543092-63543114 TCACTGCCACCAAGGCCACCTGG + Intronic
1069911281 10:71761369-71761391 TCACTGTCACAAATGGAGCCAGG + Intronic
1071941336 10:90594783-90594805 TCAGTGCCACAATGTCTACCTGG - Intergenic
1072409331 10:95185102-95185124 TAGGTGACACAAAGGGGACCTGG + Intergenic
1072420653 10:95288652-95288674 TCATTGTCATAAAGGGACCCTGG - Intronic
1072928572 10:99639667-99639689 TCAGTGCCAAGAAGGTAGCCTGG - Intergenic
1073907578 10:108301053-108301075 TCAGTGCCACGAATTGAACTTGG + Intergenic
1079569505 11:21924732-21924754 AAAGTGGCACAAAGGGAGCCCGG - Intergenic
1081157407 11:39711457-39711479 TCATTGTCACAAAGGGAACATGG - Intergenic
1081618541 11:44604902-44604924 TCACTGCCCAACAGGGAACCAGG - Intronic
1083686965 11:64382340-64382362 CCAGTGGGGCAAAGGGAACCAGG + Intergenic
1084631741 11:70356544-70356566 TCAACGTCACAAAGTGAACCTGG - Intronic
1084681216 11:70667543-70667565 CCAGTGGGAGAAAGGGAACCCGG - Intronic
1085055700 11:73402342-73402364 TCAGTGCCTCGCTGGGAACCTGG + Intronic
1085821769 11:79801505-79801527 TCAGTGCCTAGAAGAGAACCTGG + Intergenic
1086127862 11:83368026-83368048 TCAGTGCCACAGAGTGAAACCGG - Intergenic
1086155005 11:83656009-83656031 GCTGTGCCACAAAGGCACCCTGG + Intronic
1087275681 11:96158398-96158420 CCTGTGCCACACAGGGAAACTGG - Intronic
1088289650 11:108222618-108222640 TCAGTGCCGCCACTGGAACCAGG - Exonic
1089974062 11:122717315-122717337 TCAGGGGCAGAGAGGGAACCTGG - Intronic
1090780926 11:130005562-130005584 TAAGTGCTACAAAGTAAACCAGG + Intergenic
1092121124 12:6044595-6044617 CCAGTCCCACACAGGGACCCTGG - Intronic
1093482137 12:19615064-19615086 TCAGAGCCTCAAAGAGAACTAGG - Intronic
1097676381 12:62606626-62606648 TCATTGCCCCAAAGGAAAACAGG + Intergenic
1097996298 12:65891431-65891453 CCAGTGTCACAATGGGAACTGGG - Intronic
1100699466 12:97130908-97130930 TCAGTGCCTCAAATAGTACCTGG + Intergenic
1101171945 12:102106740-102106762 TCAGGACCACAAAGCGGACCTGG - Intronic
1104925252 12:132310633-132310655 TCAGTGACTCAAAGAGAAGCTGG - Intronic
1105678933 13:22705877-22705899 TCTGTGCCACACAGGGGAGCTGG - Intergenic
1105813655 13:24014852-24014874 AAAGTGCCAAAAAGGGAACCTGG - Intronic
1106447656 13:29850607-29850629 TGAGTGCGACTAAGGGAAACGGG + Exonic
1111676951 13:91399268-91399290 CGAGTGCCACCAAGGGAGCCTGG - Intronic
1112318462 13:98385836-98385858 TCTCTGTCACCAAGGGAACCAGG - Intronic
1112650061 13:101386360-101386382 TCTGTCCCACAGAGTGAACCAGG + Intronic
1112964046 13:105165093-105165115 CCTCTGCCACAAAGGGAACAGGG + Intergenic
1113243129 13:108362269-108362291 ACAGTTCCATAAAGGGATCCAGG + Intergenic
1114529941 14:23389314-23389336 TCAGTGCCAGAAATGGAGCCTGG - Intronic
1115320077 14:32070419-32070441 AGACTGCCACAAACGGAACCAGG + Intergenic
1115391562 14:32860479-32860501 ACAGAGCCACAGAGGGAGCCAGG - Intergenic
1116507804 14:45706484-45706506 GTAGTGACACAAAGTGAACCGGG - Intergenic
1116943770 14:50816569-50816591 TCAGTGCCAGGATGGGATCCTGG - Intronic
1118333933 14:64835727-64835749 TCAGAGCTAGAAAGGGAATCTGG + Intronic
1119176089 14:72568556-72568578 CAAGTGACACACAGGGAACCAGG - Intergenic
1119581274 14:75783706-75783728 TCATTGACACAAAGGGAAACAGG + Intronic
1120204001 14:81567964-81567986 TAAGTGCCACAAAGAGAATTTGG - Intergenic
1121655727 14:95594210-95594232 AGAGTGTCACCAAGGGAACCGGG - Intergenic
1121808155 14:96851033-96851055 TCTGTTACACAAAGGAAACCAGG + Intronic
1122207570 14:100155642-100155664 CCAGAGCCACAAGGGGATCCTGG - Intronic
1122859673 14:104576953-104576975 TCACTGCCACAGAGGGAGCTGGG + Intronic
1123666815 15:22614623-22614645 TCAGGGCCCCAAGGGGAAACTGG + Intergenic
1124320655 15:28709196-28709218 TCAGGGCCCCAAGGGGAAACTGG + Intronic
1124481839 15:30086153-30086175 TCAGGGCCCCAAGGGGAAACTGG - Intronic
1124488295 15:30138251-30138273 TCAGGGCCCCAAGGGGAAACTGG - Intronic
1124521754 15:30411048-30411070 TCAGGGCCCCAAGGGGAAACTGG + Intronic
1124536910 15:30555171-30555193 TCAGGGCCCCAAGGGGAAACTGG - Intronic
1124543385 15:30607225-30607247 TCAGGGCCCCAAGGGGAAACTGG - Intronic
1124755232 15:32400069-32400091 TCAGGGCCCCAAGGGGAAACTGG + Intronic
1124761740 15:32452420-32452442 TCAGGGCCCCAAGGGGAAACTGG + Intronic
1124776887 15:32596648-32596670 TCAGGGCCCCAAGGGGAAACTGG - Intronic
1124976571 15:34532775-34532797 TCAGGGCCCCAAGGGGAAACCGG + Intronic
1127774023 15:62251833-62251855 TCAGGGCCCCAAGGGGAAACTGG + Intergenic
1127775611 15:62262072-62262094 TCAGGGCCCCAAGGGGAAACTGG + Intergenic
1129029403 15:72607641-72607663 TCAGGGCCCCAAGGGGAAACTGG - Intergenic
1129209948 15:74062677-74062699 TCAGTCCCTCCAAGGGTACCTGG - Intergenic
1129515944 15:76157641-76157663 TCAGGGCAATACAGGGAACCAGG - Intronic
1130732339 15:86509962-86509984 TCAGTGCCACAGAAGAAATCAGG - Intronic
1132185872 15:99801250-99801272 TCAGTCCCTCCAAGGGTACCTGG + Intergenic
1132429808 15:101751448-101751470 TCAGTCCCTCCAAGGGTACCTGG - Intergenic
1134227265 16:12400648-12400670 TAAGTGCCACAAAGGAACACTGG - Intronic
1134686578 16:16163051-16163073 TCTGAGCCACAAAGGGGGCCTGG + Exonic
1135729734 16:24883974-24883996 TCTGGGTCACCAAGGGAACCTGG - Intronic
1138108891 16:54307611-54307633 TCTGTGCCACACAAGAAACCAGG + Intergenic
1138865335 16:60811531-60811553 TCAGAGGCACAAAGGGACACTGG + Intergenic
1139126465 16:64084025-64084047 ACTGTGGCACAAAGGGAACCAGG - Intergenic
1140896969 16:79333262-79333284 TCAGATCCACAAAGGCAAACAGG - Intergenic
1144807904 17:17979726-17979748 TCAGGGCCAGAAAAGGCACCTGG + Intronic
1145771188 17:27494509-27494531 TCAGTGCCTTAAATGGACCCAGG + Intronic
1147865076 17:43546415-43546437 TCAATGAAACAAAGGGAAACGGG - Exonic
1148740057 17:49887636-49887658 TCACTACCACAAAGGGAAGAAGG - Intergenic
1150190600 17:63233558-63233580 TCAGTCCCAATAAGAGAACCTGG + Intronic
1150785099 17:68155960-68155982 TCAGTGCCAGAAATGAAAGCTGG + Intergenic
1154981587 18:21506599-21506621 TCAGTGCTCCAAAGGGAAGAGGG - Intronic
1155538955 18:26846995-26847017 TTAGTGCCCCAAAGAGAACCGGG - Intergenic
1155619737 18:27764513-27764535 TCATTGGCAGAAAGGGAACTAGG - Intergenic
1156220969 18:35051554-35051576 TCTGTACCGAAAAGGGAACCTGG + Intronic
1156425560 18:37008146-37008168 GCAGTGCCACAAGAGGAACCAGG + Intronic
1157405973 18:47423147-47423169 TCAGTTCTACAAAGAGACCCAGG - Intergenic
1159057436 18:63479804-63479826 TAAGTGGCAGAAAGGGAACAAGG + Intronic
1161216364 19:3096848-3096870 TCAGTGCCACGCAGAGAGCCGGG + Intronic
1161222093 19:3122490-3122512 TCAGTGCCTCAAGGGGCCCCGGG - Exonic
1163538230 19:17890747-17890769 CCAGTCCCACTAAGGGACCCTGG - Intronic
1163755552 19:19104466-19104488 ACAGAGCCAGAAAGGGAACCTGG + Intronic
1165320332 19:35080878-35080900 TCTGTGCCACAAGGGGTTCCCGG + Intergenic
1166538535 19:43591280-43591302 TCAGAGCCTCAGAGGGAAACAGG - Exonic
925497472 2:4468582-4468604 TCAGGGCCAAAAAGGGAAGTGGG - Intergenic
928829934 2:35468634-35468656 TAAGTGACACAAAGGGAAACTGG + Intergenic
929902232 2:46015166-46015188 TCAATGCCTGAATGGGAACCTGG - Intronic
932883202 2:75523523-75523545 TCAGTGCTACAAAGAAAATCGGG - Intronic
934313204 2:91889485-91889507 TCATTTCCAGAAAGGGAAGCTGG - Intergenic
934603665 2:95678374-95678396 TCAGTGCCAACAAGGGGCCCTGG - Intergenic
934923771 2:98367073-98367095 TCAGTCCCACTGAGAGAACCTGG + Intronic
935059640 2:99596117-99596139 TCATGGCCACCAACGGAACCGGG + Intronic
936537045 2:113320612-113320634 TCAGTGCCAACAAGGGGCCCTGG - Intergenic
938067972 2:128292179-128292201 TCAGTGCCACAGAGACCACCTGG + Intronic
939737488 2:145866460-145866482 TCAGTGCTACAAAGTGAATATGG - Intergenic
940530737 2:154873344-154873366 TCAGTGTCATAAGGGGAACAGGG - Intergenic
941757238 2:169200369-169200391 TAAGTACCACAAAGGGAATGAGG + Intronic
947629761 2:231644561-231644583 TCAAGGACACACAGGGAACCCGG + Intergenic
948542503 2:238700606-238700628 CCAGGGCCACAAAGTGAGCCTGG + Intergenic
948664494 2:239526627-239526649 TCGGTGCCAGAAAGGGCTCCAGG + Intergenic
1172241209 20:33413574-33413596 TCTGTGCAACAAGGAGAACCTGG - Intronic
1173018843 20:39250183-39250205 TCAGTGCCACATAGGGTTCTCGG - Intergenic
1173619178 20:44423630-44423652 GCAGAGCCACAATGGGAACTTGG - Intronic
1173705967 20:45110538-45110560 TCACTGCAACACAGGGAACTGGG + Exonic
1174077898 20:47951192-47951214 GCAGGGCCACATGGGGAACCTGG + Intergenic
1174077909 20:47951228-47951250 GCAGGGCCACACGGGGAACCCGG + Intergenic
1174077921 20:47951264-47951286 GCAGGGCCACACGGGGAACCCGG + Intergenic
1174077933 20:47951300-47951322 GCAGGGCCACACGGGGAACCTGG + Intergenic
1182188877 22:28438011-28438033 TCAGTGCAACCAAGAGACCCAGG - Intronic
1184496898 22:44847182-44847204 TCAGAGCCAGAAAGAGAAACAGG - Intronic
1184538584 22:45104421-45104443 GCAGGGCCACAGAGGGACCCAGG - Intergenic
1185033846 22:48460624-48460646 GCAGTGCCAGGAAGGGAACCGGG + Intergenic
1185071560 22:48659465-48659487 TCAGTGGCACAGAGGGACTCAGG + Intronic
950384597 3:12647997-12648019 TCAGTTCCACAAATGATACCTGG + Intronic
950434826 3:12973145-12973167 TCAGTGTCACGTAGGAAACCCGG - Intronic
950502425 3:13372882-13372904 ACAGTGGCACAAGGGGAAACTGG + Intronic
951583084 3:24186261-24186283 TCAGTGGCACTAGGAGAACCTGG - Intronic
951727663 3:25777822-25777844 TCAGGGCCTGAAATGGAACCTGG + Intronic
952884767 3:38005770-38005792 TCTGAGCCACAGAGGGGACCTGG - Exonic
954294749 3:49668025-49668047 CCTGTGCCACAGAGGGATCCGGG - Exonic
954479763 3:50788120-50788142 AAAGTGTAACAAAGGGAACCAGG - Intronic
959752107 3:109850069-109850091 TCAGTGCCAGACAGGAACCCAGG + Intergenic
959883635 3:111474152-111474174 TCAGTCCCAGTAAGAGAACCTGG + Intronic
961514771 3:127425657-127425679 TCAGAGCCACAGAAGGAAGCTGG + Intergenic
964689478 3:159434276-159434298 TCAGTGTCCCAGAGGGACCCAGG - Intronic
967731171 3:192908341-192908363 TAAGGGCCACAAAAGGGACCAGG + Intronic
968480857 4:832509-832531 TCAGCCCCACAAAGGAAACGGGG + Intergenic
970806864 4:20046686-20046708 ACAGTCCCCTAAAGGGAACCAGG + Intergenic
975857368 4:78639051-78639073 TCAGTGTCACAGAGGTCACCTGG - Intergenic
977251584 4:94694724-94694746 TCAGTCCCAAAAAGAGACCCGGG + Intergenic
978765309 4:112399248-112399270 TCAGAGCAAGGAAGGGAACCAGG + Intronic
979912633 4:126388481-126388503 ATAGTGCCACAAAAGTAACCTGG - Intergenic
981573127 4:146175151-146175173 TCAGTGCTACTATGGGAACTTGG - Intergenic
985943070 5:3154051-3154073 TCAGTGACTCAAAGAGAACTTGG + Intergenic
988595089 5:32583801-32583823 TCTGTGTCACTGAGGGAACCTGG - Intronic
992618384 5:78568410-78568432 TTAGTGCCACACAGAGAACACGG + Intronic
994350603 5:98742187-98742209 TCAGTTCCACTGAGAGAACCTGG - Intergenic
994987520 5:106956370-106956392 TCGGTGCCACAAGGGGGAACAGG - Intergenic
996005759 5:118419468-118419490 TCAGTCCCAAAGAGAGAACCTGG - Intergenic
996864250 5:128101727-128101749 TCAGTGCCACTAAGGCAAATAGG + Intronic
998135123 5:139670390-139670412 TCAGAGGCACAAACTGAACCTGG + Intronic
998161437 5:139814871-139814893 TGAGGGCCCCAAAGGGGACCAGG + Intronic
999044221 5:148449997-148450019 TTAGTGAGACAAAGGGAACAGGG - Intergenic
1003347866 6:5287445-5287467 TCAGTGCCAAAAAGAGAATCAGG - Intronic
1003991479 6:11490871-11490893 TCACAGCCACCAAGGGAACCAGG + Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1009547044 6:65033522-65033544 TCTGTGGCTCAAAGGGACCCAGG + Intronic
1010180388 6:73079972-73079994 TCAGTGGCAAAAGGGGCACCTGG - Intronic
1012647115 6:101699555-101699577 TCAGTCCCTCAAAGGTACCCTGG + Intronic
1014254168 6:119144852-119144874 TCAGTGACACAAAGACAAGCAGG - Intronic
1014552889 6:122809044-122809066 TATGTGCCAAAAAGTGAACCAGG + Intronic
1016147511 6:140694199-140694221 TCAGTTCCTCAAGAGGAACCAGG + Intergenic
1022301281 7:29104867-29104889 TCATTTCCACAAAGGAAATCAGG + Intronic
1022451807 7:30523073-30523095 TCAGGGCCCCAAGGGGAAACTGG + Intronic
1024270212 7:47636103-47636125 TGAGTGCCAGAAATGGGACCTGG + Intergenic
1024533037 7:50408998-50409020 TCAGTGTCAAAAAGAGTACCTGG + Intergenic
1026367039 7:69659108-69659130 CCAGTGCCACAAATGTAAACAGG + Intronic
1027950776 7:84812192-84812214 TCATTGCCAAAAAGGAAACAAGG + Intergenic
1027990757 7:85357990-85358012 TAAGTGCCACTTAGGGAAACAGG - Intergenic
1028092069 7:86715241-86715263 TGAGTGCAACCAAGGTAACCAGG - Intronic
1028970655 7:96854946-96854968 TCAGAGTCACAAAGAGAATCTGG - Intergenic
1029209972 7:98899375-98899397 TAAATGCCACAATGGTAACCCGG + Intronic
1029853915 7:103494042-103494064 TCTGGGCCACAATGTGAACCTGG + Intronic
1030900018 7:115111854-115111876 TCAGAGCCACAAAAGAAACATGG + Intergenic
1032404107 7:131643333-131643355 ACAGAACCACAAAGAGAACCCGG - Intergenic
1033003127 7:137529670-137529692 TCACTGCCACAAAAGGAAACAGG - Intronic
1034353723 7:150434267-150434289 TCAGTGACAAAGAGGGAAGCTGG - Intergenic
1035667142 8:1387789-1387811 CCTGTGCCACAATCGGAACCAGG + Intergenic
1037519184 8:19663110-19663132 TGAATGCCACAAAGGGATCTGGG - Intronic
1039025482 8:33253257-33253279 TCAGTCCCAGCAAGAGAACCAGG + Intergenic
1039976508 8:42371049-42371071 TCAGTGCCACAAAGGGAACCTGG - Intronic
1040666900 8:49644257-49644279 TGAGTGACATAAAGGGACCCTGG + Intergenic
1041436954 8:57852568-57852590 ACAGGGCCAGAGAGGGAACCAGG + Intergenic
1044508685 8:93049852-93049874 TCAGTCCCAATAAGAGAACCTGG + Intergenic
1044553876 8:93541355-93541377 TCAGTCCTACAAAGGCAATCTGG - Intergenic
1046378028 8:113412705-113412727 TCAGTGCAACGAAGGAAAACAGG - Intronic
1046802285 8:118441831-118441853 TCAGTGCCAGAGAGTGAATCAGG - Intronic
1047981209 8:130184576-130184598 GAAGTGCTACAAAGGGTACCTGG + Intronic
1048428991 8:134350827-134350849 TCAGAGCTACAAAGAGAAGCTGG - Intergenic
1052828017 9:33191239-33191261 TCAGTGTCACCAGGGGAATCAGG + Intergenic
1058092960 9:100826328-100826350 TCAGTGGCACAAAGAGGAGCTGG - Intergenic
1059263711 9:113005831-113005853 TCAGTGCCACCCACAGAACCTGG + Intergenic
1061887526 9:133599354-133599376 ATTGTGCCACAAAGGGAACCTGG + Intergenic
1062294837 9:135818927-135818949 TCAGTGCCAGCAACGGGACCGGG + Intronic
1062529024 9:136991942-136991964 GCAGAGCCACGGAGGGAACCTGG + Intergenic
1185659913 X:1719546-1719568 TCAGGGCCACGCAGGGTACCAGG + Intergenic
1185912337 X:3993818-3993840 TCACAGCCACAAAGAGAAACAGG - Intergenic
1187958984 X:24550092-24550114 ACAGAGGCACAAAGCGAACCAGG - Intergenic
1189173637 X:38932791-38932813 TCATTACCAAAAAGAGAACCAGG - Intergenic
1191034289 X:56008328-56008350 TCAGTCCCAGCAAGAGAACCTGG - Intergenic
1192446318 X:71214192-71214214 TCACTGCTAGAAAGGGAGCCAGG - Intergenic
1193575843 X:83194322-83194344 TCAGGGCCAGAAACAGAACCTGG + Intergenic
1196597594 X:117563318-117563340 TCATTGTCACAAAGGGAGCATGG - Intergenic
1196754654 X:119147569-119147591 GCAGTGCCACAAAAGCATCCAGG + Exonic
1197424125 X:126273551-126273573 TCAGTCCCACTGAGAGAACCTGG + Intergenic
1199088047 X:143651841-143651863 TCATTGCCACAAATGAAAACAGG + Intergenic