ID: 1039977940

View in Genome Browser
Species Human (GRCh38)
Location 8:42383219-42383241
Sequence GGTAAGGCCAGCCCTCCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039977939_1039977940 -10 Left 1039977939 8:42383206-42383228 CCTGAGGTCAGAAGGTAAGGCCA No data
Right 1039977940 8:42383219-42383241 GGTAAGGCCAGCCCTCCACAAGG No data
1039977938_1039977940 -9 Left 1039977938 8:42383205-42383227 CCCTGAGGTCAGAAGGTAAGGCC No data
Right 1039977940 8:42383219-42383241 GGTAAGGCCAGCCCTCCACAAGG No data
1039977935_1039977940 1 Left 1039977935 8:42383195-42383217 CCATTTGGTTCCCTGAGGTCAGA No data
Right 1039977940 8:42383219-42383241 GGTAAGGCCAGCCCTCCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039977940 Original CRISPR GGTAAGGCCAGCCCTCCACA AGG Intergenic
No off target data available for this crispr