ID: 1039978335

View in Genome Browser
Species Human (GRCh38)
Location 8:42385663-42385685
Sequence CAGGAGCCTGGACTTTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039978335_1039978340 4 Left 1039978335 8:42385663-42385685 CCAGCACAAAGTCCAGGCTCCTG No data
Right 1039978340 8:42385690-42385712 CAGGAGCATTTCCCAATTTCTGG No data
1039978335_1039978341 7 Left 1039978335 8:42385663-42385685 CCAGCACAAAGTCCAGGCTCCTG No data
Right 1039978341 8:42385693-42385715 GAGCATTTCCCAATTTCTGGTGG No data
1039978335_1039978344 20 Left 1039978335 8:42385663-42385685 CCAGCACAAAGTCCAGGCTCCTG No data
Right 1039978344 8:42385706-42385728 TTTCTGGTGGAAATTTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039978335 Original CRISPR CAGGAGCCTGGACTTTGTGC TGG (reversed) Intergenic
No off target data available for this crispr