ID: 1039978340

View in Genome Browser
Species Human (GRCh38)
Location 8:42385690-42385712
Sequence CAGGAGCATTTCCCAATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039978335_1039978340 4 Left 1039978335 8:42385663-42385685 CCAGCACAAAGTCCAGGCTCCTG No data
Right 1039978340 8:42385690-42385712 CAGGAGCATTTCCCAATTTCTGG No data
1039978334_1039978340 5 Left 1039978334 8:42385662-42385684 CCCAGCACAAAGTCCAGGCTCCT No data
Right 1039978340 8:42385690-42385712 CAGGAGCATTTCCCAATTTCTGG No data
1039978337_1039978340 -8 Left 1039978337 8:42385675-42385697 CCAGGCTCCTGATTCCAGGAGCA No data
Right 1039978340 8:42385690-42385712 CAGGAGCATTTCCCAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039978340 Original CRISPR CAGGAGCATTTCCCAATTTC TGG Intergenic
No off target data available for this crispr