ID: 1039979159

View in Genome Browser
Species Human (GRCh38)
Location 8:42391956-42391978
Sequence GGCCCACCGCTCTCCGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 198}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039979159_1039979170 9 Left 1039979159 8:42391956-42391978 CCAGTCCCGGAGAGCGGTGGGCC 0: 1
1: 0
2: 1
3: 4
4: 198
Right 1039979170 8:42391988-42392010 CAGAGCGCCAGGCGGGAGGCGGG 0: 1
1: 0
2: 5
3: 32
4: 375
1039979159_1039979175 29 Left 1039979159 8:42391956-42391978 CCAGTCCCGGAGAGCGGTGGGCC 0: 1
1: 0
2: 1
3: 4
4: 198
Right 1039979175 8:42392008-42392030 GGGCCTAACGGAGGCTCTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 101
1039979159_1039979172 17 Left 1039979159 8:42391956-42391978 CCAGTCCCGGAGAGCGGTGGGCC 0: 1
1: 0
2: 1
3: 4
4: 198
Right 1039979172 8:42391996-42392018 CAGGCGGGAGGCGGGCCTAACGG 0: 1
1: 0
2: 0
3: 10
4: 111
1039979159_1039979166 2 Left 1039979159 8:42391956-42391978 CCAGTCCCGGAGAGCGGTGGGCC 0: 1
1: 0
2: 1
3: 4
4: 198
Right 1039979166 8:42391981-42392003 GGCCGAGCAGAGCGCCAGGCGGG 0: 1
1: 0
2: 1
3: 18
4: 260
1039979159_1039979165 1 Left 1039979159 8:42391956-42391978 CCAGTCCCGGAGAGCGGTGGGCC 0: 1
1: 0
2: 1
3: 4
4: 198
Right 1039979165 8:42391980-42392002 CGGCCGAGCAGAGCGCCAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 109
1039979159_1039979169 8 Left 1039979159 8:42391956-42391978 CCAGTCCCGGAGAGCGGTGGGCC 0: 1
1: 0
2: 1
3: 4
4: 198
Right 1039979169 8:42391987-42392009 GCAGAGCGCCAGGCGGGAGGCGG 0: 1
1: 0
2: 5
3: 40
4: 365
1039979159_1039979174 28 Left 1039979159 8:42391956-42391978 CCAGTCCCGGAGAGCGGTGGGCC 0: 1
1: 0
2: 1
3: 4
4: 198
Right 1039979174 8:42392007-42392029 CGGGCCTAACGGAGGCTCTGTGG 0: 1
1: 0
2: 0
3: 4
4: 79
1039979159_1039979168 5 Left 1039979159 8:42391956-42391978 CCAGTCCCGGAGAGCGGTGGGCC 0: 1
1: 0
2: 1
3: 4
4: 198
Right 1039979168 8:42391984-42392006 CGAGCAGAGCGCCAGGCGGGAGG 0: 1
1: 0
2: 2
3: 5
4: 174
1039979159_1039979173 20 Left 1039979159 8:42391956-42391978 CCAGTCCCGGAGAGCGGTGGGCC 0: 1
1: 0
2: 1
3: 4
4: 198
Right 1039979173 8:42391999-42392021 GCGGGAGGCGGGCCTAACGGAGG 0: 1
1: 0
2: 0
3: 6
4: 95
1039979159_1039979164 -2 Left 1039979159 8:42391956-42391978 CCAGTCCCGGAGAGCGGTGGGCC 0: 1
1: 0
2: 1
3: 4
4: 198
Right 1039979164 8:42391977-42391999 CCGCGGCCGAGCAGAGCGCCAGG 0: 1
1: 0
2: 2
3: 21
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039979159 Original CRISPR GGCCCACCGCTCTCCGGGAC TGG (reversed) Intronic
901238575 1:7680289-7680311 GGCCCAGCGCCCGCGGGGACGGG - Intronic
901855823 1:12043485-12043507 CCCCCACCTCTCTCCCGGACGGG - Intergenic
902019084 1:13329436-13329458 CCCCCACCGCCCTCCCGGACGGG - Intergenic
903458435 1:23504366-23504388 CCCCCACCTCCCTCCGGGACGGG - Intergenic
903637497 1:24832914-24832936 CCCCCACCGCCCTCCCGGACGGG + Intronic
904532188 1:31176845-31176867 CCCCCACCTCTCTCCCGGACGGG - Intergenic
904623703 1:31790529-31790551 GTCCCACCTCTCTCTGGAACAGG + Exonic
904784689 1:32974849-32974871 CCCCCACCTCTCTCCCGGACTGG + Intergenic
904857295 1:33509286-33509308 CCCCCACCTCCCTCCGGGACGGG + Intergenic
905599115 1:39234601-39234623 GCCCCACCTCCCTCCCGGACGGG + Intronic
905868246 1:41387945-41387967 GGCCCAGCGCTCTTGGGAACAGG + Intergenic
906090039 1:43171554-43171576 GATCCACCGATCTCCGGTACCGG + Exonic
907140670 1:52182109-52182131 CCCCCACCTCTCTCCTGGACGGG - Intronic
907797566 1:57732702-57732724 GGCTGACTGCTGTCCGGGACAGG + Intronic
909640979 1:77869921-77869943 CGCCCACCTCCCTCCCGGACGGG + Intronic
913113894 1:115679501-115679523 GGCCCACCGCCTTCCAGCACGGG - Intronic
915340143 1:155172963-155172985 GGCCCACCGAGCTTCCGGACCGG - Intronic
916792549 1:168136819-168136841 TCCCCGCCGCGCTCCGGGACTGG + Intronic
920886809 1:209937935-209937957 GGCCCGTGGCTCTCCGGGCCGGG + Intergenic
921140025 1:212298455-212298477 CCCCCACCGCCCTCCCGGACGGG + Intronic
922464714 1:225839026-225839048 GACACACCGCCCTCCGGGGCTGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923938282 1:238790089-238790111 TGCCCTCTGCTTTCCGGGACCGG - Intergenic
1063776777 10:9273400-9273422 CCCCCACCTCCCTCCGGGACGGG + Intergenic
1063965803 10:11344806-11344828 GGCGCACAACTCTCTGGGACCGG + Intergenic
1065840399 10:29696803-29696825 GCCCCACCTCCCTCCCGGACGGG - Intronic
1066085812 10:31970973-31970995 CCCCCACCGCCCTCCCGGACGGG - Intergenic
1067030970 10:42878700-42878722 GCCTCCCCTCTCTCCGGGACGGG - Intergenic
1067225747 10:44374662-44374684 GGGACACCACGCTCCGGGACAGG + Intronic
1070755159 10:78987574-78987596 GGCTCACCTCTCTCTGGGTCAGG - Intergenic
1072117179 10:92376483-92376505 CCCCCACCTCCCTCCGGGACGGG - Intergenic
1072772469 10:98152928-98152950 CCCCCACCTCTCTCCCGGACAGG - Intronic
1077025590 11:438545-438567 GGCCCACCAGCCTCCAGGACCGG + Intronic
1077414360 11:2417949-2417971 TGCCCACCGCCCACCGGGCCCGG + Intronic
1081950408 11:47038637-47038659 CCCCCACCTCTCTCCCGGACGGG + Intronic
1084641936 11:70431407-70431429 GGCCCACCCCTCTCCGGGCGTGG - Intronic
1084924561 11:72502148-72502170 CCCCCACCTCCCTCCGGGACGGG + Intergenic
1085513133 11:77098333-77098355 CCCCCACCTCCCTCCGGGACGGG + Intronic
1086881712 11:92158220-92158242 GCCCCACCTCGCTCCCGGACGGG - Intergenic
1088578979 11:111298763-111298785 GGGCCTCTGCCCTCCGGGACAGG - Intronic
1089264736 11:117251259-117251281 CCCCCACCTCCCTCCGGGACGGG + Intronic
1091378824 12:42661-42683 CCCCCACCGCCCTCCCGGACGGG - Intergenic
1092143817 12:6201129-6201151 GGCCCCCGACTCTCAGGGACTGG - Intronic
1095571199 12:43685467-43685489 GACCCACCTCCCTCCCGGACGGG - Intergenic
1096245719 12:49984556-49984578 GGCCCAGTGCTCTCCAGGAAGGG - Intronic
1096337008 12:50764274-50764296 GCCTCGCCGCTCTCCGGGGCGGG - Exonic
1100570276 12:95840475-95840497 CCCCCACCGCCCTCCCGGACGGG + Intergenic
1101820999 12:108184231-108184253 GGCACAAGGTTCTCCGGGACAGG + Intronic
1104655106 12:130568466-130568488 TGCTCACGGCTCTCTGGGACTGG - Intronic
1105322720 13:19344474-19344496 AGCCCAGCGCCCTCGGGGACAGG + Intergenic
1105367852 13:19779538-19779560 CCCCCACCTCCCTCCGGGACGGG - Intronic
1105874895 13:24542241-24542263 AGCCCAGCGCCCTCGGGGACAGG - Intergenic
1106560036 13:30839432-30839454 CCCCCACCTCCCTCCGGGACGGG + Intergenic
1106777957 13:33026724-33026746 GGGGCACCGCTCTCCAGGCCAGG - Intronic
1107837071 13:44420877-44420899 GGCCCACTGGGCTCCAGGACCGG - Intergenic
1108059164 13:46515563-46515585 CCCCCACCGCCCTCCCGGACGGG + Intergenic
1112420459 13:99242735-99242757 CCCCCACCTCTCTCCCGGACGGG + Intronic
1115271681 14:31560157-31560179 CCCCCACCTCCCTCCGGGACGGG + Intronic
1116191946 14:41674560-41674582 CCCCCACCTCTCTCCAGGACGGG + Intronic
1117141099 14:52791667-52791689 CGCCCCTCGCTCTCCGGGCCTGG - Intronic
1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG + Intergenic
1118213707 14:63788533-63788555 GGAGCCCCGCTCTCCTGGACAGG - Intergenic
1118340772 14:64894779-64894801 CCCCCACCGCCCTCCCGGACGGG + Intergenic
1119702015 14:76761912-76761934 GGCCCGCGGCTCAGCGGGACCGG - Intergenic
1120309853 14:82814432-82814454 CCCCCACCTCCCTCCGGGACGGG + Intergenic
1122688519 14:103521119-103521141 GGCCGGCCGCGCTCCGGGTCTGG - Intronic
1122815255 14:104309035-104309057 GGCCCACAGGGCTCCGGGATAGG - Intergenic
1123938158 15:25203950-25203972 TGCCCACCTCTCTCCGGGGATGG - Intergenic
1124014035 15:25861775-25861797 GACCCACCTTTCTCAGGGACAGG + Intronic
1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG + Intronic
1128489831 15:68134850-68134872 CCCCCACCGCCCTCCCGGACGGG + Intronic
1128586961 15:68859838-68859860 CCCCCACCTCCCTCCGGGACGGG + Intronic
1128587118 15:68860191-68860213 CCCCCACCTCCCTCCGGGACGGG + Intronic
1128938522 15:71768992-71769014 CGCCCACCTCCCTCCCGGACGGG - Intronic
1128938651 15:71769270-71769292 CGCCCACCTCCCTCCCGGACGGG - Intronic
1129389697 15:75214422-75214444 GGCCCTCCCTTCTCCGGCACAGG - Intergenic
1133074750 16:3271481-3271503 CCCCCACCTCTCTCCCGGACGGG + Intronic
1133802183 16:9092511-9092533 GGGTCCCCGCTCTCCGGGCCCGG + Intronic
1136426001 16:30169458-30169480 CCCCCACCTCCCTCCGGGACGGG - Intergenic
1141805819 16:86340856-86340878 GGCGCGCCGCTCTCCCGGATGGG - Intergenic
1147809641 17:43159324-43159346 CCCCCACCTCCCTCCGGGACGGG + Intergenic
1147826221 17:43271792-43271814 GGCCCACCGCCCTCTGTGAAAGG - Intergenic
1147852247 17:43452100-43452122 CGCCCACCTCCCTCCTGGACGGG - Intergenic
1148632879 17:49125731-49125753 CCCCCACCTCCCTCCGGGACGGG - Intergenic
1150213937 17:63456636-63456658 GCCCCACCTCCCTCCCGGACGGG - Intergenic
1151856224 17:76724023-76724045 GGGCCACCACGCTCCGGAACTGG - Exonic
1152610772 17:81314126-81314148 GGGCCACCTCTCCCCGGGCCTGG - Intronic
1156488963 18:37485334-37485356 GGCCCAACGGGATCCGGGACAGG - Intronic
1158459242 18:57632840-57632862 CCCCCACCTCTCTCCCGGACGGG + Intergenic
1160952933 19:1676118-1676140 GGCCCAGCGCTCCCGGGAACGGG + Intergenic
1161043411 19:2121940-2121962 GGCCCACGGCTCTCCGGGCCGGG + Intronic
1164066841 19:21722071-21722093 CCCCCACCGCCCTCCCGGACGGG - Intergenic
1164168447 19:22702869-22702891 CCCCCACCTCCCTCCGGGACGGG + Intergenic
1164244724 19:23419507-23419529 CCCCCACCTCCCTCCGGGACGGG - Intergenic
1165349028 19:35266770-35266792 GGCCCACCCCTCTCCCTTACAGG - Intronic
1165481880 19:36069175-36069197 CCCCCACCTCCCTCCGGGACGGG + Intronic
1167313864 19:48752796-48752818 GGCCCACCGCTCCCCAGATCGGG + Exonic
1167998490 19:53426027-53426049 GGCCCACCTCTTCCCCGGACAGG - Intronic
1168008618 19:53512133-53512155 GGCCCACCTCTTCCCCGGACCGG - Intergenic
1168529852 19:57119089-57119111 GGCCCCTCGCGCGCCGGGACAGG + Intergenic
927747280 2:25634091-25634113 CGCCCACCTCCCTCCCGGACGGG - Intronic
929690212 2:44067307-44067329 CGCCCACCTCCCTCCCGGACGGG + Intergenic
934309838 2:91852294-91852316 CGCCCACCTCCCTCCCGGACAGG - Intergenic
934309857 2:91852343-91852365 CGCCCACCTCTCTCCCGGACGGG - Intergenic
934753033 2:96806135-96806157 CCCCCACCGCCCTCCCGGACGGG + Intronic
940299201 2:152160633-152160655 CCCCCACCGCCCTCCCGGACGGG - Intronic
942454859 2:176130589-176130611 TCCCCGCCGCCCTCCGGGACTGG + Exonic
943578080 2:189653750-189653772 CCCCCACCTCTCTCCCGGACAGG - Intergenic
944060779 2:195568134-195568156 GCCCCACCTCCCTCCCGGACGGG - Intergenic
944532760 2:200683262-200683284 CCCCCACCACTCTCCCGGACGGG + Intergenic
944598323 2:201282572-201282594 CCCCCACCGCCCTCCCGGACGGG + Intronic
944751551 2:202715260-202715282 CCCCCACCTCCCTCCGGGACGGG + Intronic
945115131 2:206401372-206401394 GCCCCACCTCCCTCCCGGACGGG + Intergenic
1168830974 20:845170-845192 GGCCAGCCGCACTCCTGGACGGG + Exonic
1169086187 20:2825100-2825122 CCCCCACCGCCCTCCCGGACGGG - Intergenic
1171473382 20:25390051-25390073 GCCCCAGCGCTCTCAGGGTCTGG + Intronic
1172051480 20:32122035-32122057 CCCCCACCTCCCTCCGGGACGGG + Intronic
1173737601 20:45373009-45373031 GGCACAGAGCTCTCCGGGATTGG - Exonic
1174178238 20:48658253-48658275 GGCCCACCTCGCTCCCTGACCGG - Intronic
1176514725 21:7775385-7775407 GTCCCATCCCTCTCTGGGACAGG + Intergenic
1176550442 21:8218710-8218732 GCCCCGCCGCGCGCCGGGACCGG + Intergenic
1176569371 21:8401749-8401771 GCCCCGCCGCGCGCCGGGACCGG + Intergenic
1176577284 21:8445980-8446002 GCCCCGCCGCGCGCCGGGACCGG + Intergenic
1178535089 21:33403948-33403970 GGGACACCCCTCTCCGGGAGAGG + Intronic
1178648838 21:34405909-34405931 GTCCCATCCCTCTCTGGGACAGG + Intronic
1179856518 21:44165073-44165095 GGCCCAGTGCTCCCCGGAACTGG - Intergenic
1183462625 22:37961394-37961416 GGCCCCCCACTCTGCTGGACTGG - Intronic
1183871376 22:40744789-40744811 CCCCCACCGCCCTCCCGGACGGG + Intergenic
1185061250 22:48607980-48608002 GGCCCATCCCTCTCCAGGCCTGG + Intronic
1203255338 22_KI270733v1_random:135049-135071 GCCCCGCCGCGCGCCGGGACCGG + Intergenic
950754762 3:15162973-15162995 CCCCCACCTCTCTCCAGGACGGG + Intergenic
954523566 3:51249533-51249555 CGCCCACCTCCCTCCCGGACCGG - Intronic
955674493 3:61434780-61434802 CCCCCACCTCCCTCCGGGACGGG + Intergenic
960921126 3:122747740-122747762 CCCCCACCTCCCTCCGGGACGGG - Intronic
961729444 3:128954947-128954969 GCCCCACCTCCCTCCCGGACGGG - Intronic
961962422 3:130868102-130868124 CCCCCACCTCCCTCCGGGACGGG - Intronic
961962705 3:130868784-130868806 CCCCCACCACTCTCCCGGACGGG - Intronic
968316787 3:197731805-197731827 CCCCCACCTCCCTCCGGGACAGG + Intronic
968705991 4:2077940-2077962 GGCCGACCCCTCTCAGGAACAGG - Intronic
968982331 4:3856995-3857017 GGCCCACAGCTCTCCCAGGCAGG + Intergenic
974076614 4:57173349-57173371 CGCCCACCTCCCTCCCGGACGGG - Intergenic
975139188 4:70902650-70902672 GGCCCAGCGCTCCCGGGGCCCGG + Intronic
975848425 4:78548237-78548259 CCCCCACCTCCCTCCGGGACGGG - Intergenic
982192020 4:152866595-152866617 CCCCCACCTCTCTCCTGGACGGG + Intronic
985731864 5:1553908-1553930 GGCCCACTCCACTCGGGGACAGG + Intergenic
985783881 5:1884155-1884177 GCGCCATCGCCCTCCGGGACCGG + Intronic
989252774 5:39334676-39334698 GCCCCACCTCCCTCCCGGACTGG - Intronic
991672566 5:69062900-69062922 CCCCCACCTCCCTCCGGGACGGG + Intergenic
991672590 5:69062949-69062971 CCCCCACCTCCCTCCGGGACGGG + Intergenic
992373850 5:76171591-76171613 CCCCCACCTCTCTCCTGGACGGG - Intronic
992801836 5:80301548-80301570 GCCCCACCTCCCTCCCGGACAGG - Intergenic
997109392 5:131058338-131058360 GCCCCACAGCTCTCCTGGTCTGG + Intergenic
1002121303 5:177006556-177006578 GGCCCGCTACTCTCCGGGAGGGG - Intronic
1002259486 5:177983863-177983885 GGCCCACGGCTCTCCAAGACTGG - Intergenic
1002621903 5:180494218-180494240 GGTCCACCGCTCTCCAGCGCGGG + Intergenic
1005837605 6:29719619-29719641 CCCCCACCGCCCTCCCGGACGGG - Intergenic
1006535528 6:34696318-34696340 GGGCCACCCCTTCCCGGGACGGG - Intronic
1007710158 6:43817724-43817746 GGCGCACCGCCCTCCAGGAACGG - Intergenic
1008926196 6:56894234-56894256 CCCCCACCGCCCTCCCGGACGGG + Intronic
1014556726 6:122848553-122848575 CCCCCACCTCCCTCCGGGACGGG + Intergenic
1014763811 6:125388323-125388345 CCCCCACCGCCCTCCCGGACGGG + Intergenic
1015643549 6:135363773-135363795 CCCCCACCTCCCTCCGGGACGGG + Intronic
1016348013 6:143136935-143136957 AGCTCATCTCTCTCCGGGACTGG + Exonic
1019343622 7:519630-519652 CGCCCTCCGCTCGCCGGGGCCGG + Intronic
1023874940 7:44281843-44281865 TGCCCACTGCTCTCCCGGCCAGG + Intronic
1024710160 7:52006369-52006391 GTCTCACAGCTCTCCAGGACTGG + Intergenic
1025000611 7:55312066-55312088 CCCCCACCTCTCTCCCGGACGGG - Intergenic
1025200471 7:56958393-56958415 GGGCCGCTGCTCTCAGGGACAGG - Intergenic
1025671473 7:63618539-63618561 GGGCCGCTGCTCTCAGGGACAGG + Intergenic
1025706947 7:63874526-63874548 GCCCCACCTCCCTCCCGGACGGG - Intergenic
1025793740 7:64718234-64718256 GACCCACCTCCCTCCCGGACGGG - Intergenic
1027373980 7:77534081-77534103 CCCCCACCTCCCTCCGGGACAGG + Intergenic
1033219703 7:139520150-139520172 CCCCCACCTCCCTCCGGGACGGG + Intergenic
1034345712 7:150384127-150384149 GGCCCTCCGCGCACCGGGTCAGG - Intronic
1035335682 7:158126006-158126028 CGCCGCCCGCTCTCCGGGGCTGG - Intronic
1039880297 8:41621406-41621428 GGCCACCCGCTCTCCAGGAAAGG + Exonic
1039979159 8:42391956-42391978 GGCCCACCGCTCTCCGGGACTGG - Intronic
1042303565 8:67310948-67310970 GCCCCACCTCCCTCCTGGACGGG - Intronic
1043502816 8:80873875-80873897 GGCCTCCAGCTCTCCGGGGCGGG + Intronic
1044507706 8:93039566-93039588 CCCCCACCGCCCTCCCGGACGGG - Intergenic
1048987115 8:139740649-139740671 TGCCTACCACTCTCCAGGACAGG - Intronic
1051276900 9:15406717-15406739 CCCCCACCTCTCTCCCGGACGGG - Intergenic
1051280926 9:15442114-15442136 CCCCCACCTCCCTCCGGGACGGG + Intronic
1051280969 9:15442206-15442228 CCCCCACCTCCCTCCGGGACGGG + Intronic
1053882732 9:42612011-42612033 GTTCCACAGCTCTCCGGGTCAGG + Intergenic
1053889937 9:42682291-42682313 GTTCCACAGCTCTCCGGGTCAGG - Intergenic
1054221759 9:62419479-62419501 GTTCCACAGCTCTCCGGGTCAGG + Intergenic
1054228955 9:62489694-62489716 GTTCCACAGCTCTCCGGGTCAGG - Intergenic
1055266396 9:74499218-74499240 AGACCACCTCTCTCCGGGTCTGG - Intronic
1057950772 9:99367625-99367647 GGCCCACAGAGATCCGGGACTGG - Intergenic
1059436716 9:114281574-114281596 GCCCCTCCTCTCTCAGGGACTGG - Intronic
1059437170 9:114283896-114283918 GGCCCAGCGCTCCCTGGGGCAGG - Intronic
1060249084 9:121971197-121971219 CCCCCACCTCCCTCCGGGACGGG - Intronic
1203785681 EBV:126220-126242 GGGCCACCAGTCTCCGGGCCGGG - Intergenic
1203471736 Un_GL000220v1:118186-118208 GCCCCGCCGCGCGCCGGGACCGG + Intergenic
1186525552 X:10244862-10244884 GGGCCAGCCCTCTCCGGGAAGGG - Intergenic
1187184153 X:16968526-16968548 CCCCCACCTCCCTCCGGGACGGG + Intronic
1188367805 X:29334079-29334101 GCCCCACCTCCCTCCCGGACGGG + Intronic
1192107183 X:68327137-68327159 CCCCCACCGCCCTCCCGGACGGG - Intronic
1192813400 X:74568671-74568693 CCCCCACCTCTCTCCCGGACCGG + Intergenic
1193132216 X:77931649-77931671 CGCCCACCTCCCTCCCGGACGGG + Intronic
1200003147 X:153072338-153072360 GGCCCTGCGCTCTCCCGGGCCGG + Intergenic
1200004576 X:153077671-153077693 GGCCCTGCGCTCTCCCGGGCCGG - Intergenic
1201335816 Y:12878912-12878934 CCCCCACCTCCCTCCGGGACGGG - Intergenic