ID: 1039981712

View in Genome Browser
Species Human (GRCh38)
Location 8:42414006-42414028
Sequence CCTTGAAGGCTCCTGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039981712_1039981718 2 Left 1039981712 8:42414006-42414028 CCAGACTCCAGGAGCCTTCAAGG No data
Right 1039981718 8:42414031-42414053 CCGGCAAGTGTGATCCCCCACGG No data
1039981712_1039981719 3 Left 1039981712 8:42414006-42414028 CCAGACTCCAGGAGCCTTCAAGG No data
Right 1039981719 8:42414032-42414054 CGGCAAGTGTGATCCCCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039981712 Original CRISPR CCTTGAAGGCTCCTGGAGTC TGG (reversed) Intergenic