ID: 1039983555

View in Genome Browser
Species Human (GRCh38)
Location 8:42428921-42428943
Sequence AGTCACCCCAGAGAATGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039983555_1039983559 21 Left 1039983555 8:42428921-42428943 CCAGAACATTCTCTGGGGTGACT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1039983559 8:42428965-42428987 ATCAATTTTAACAGAACAAGAGG 0: 1
1: 0
2: 2
3: 22
4: 274
1039983555_1039983556 -7 Left 1039983555 8:42428921-42428943 CCAGAACATTCTCTGGGGTGACT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1039983556 8:42428937-42428959 GGTGACTGCCGACTGCTGACTGG 0: 1
1: 0
2: 0
3: 3
4: 93
1039983555_1039983557 -6 Left 1039983555 8:42428921-42428943 CCAGAACATTCTCTGGGGTGACT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1039983557 8:42428938-42428960 GTGACTGCCGACTGCTGACTGGG 0: 1
1: 0
2: 0
3: 4
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039983555 Original CRISPR AGTCACCCCAGAGAATGTTC TGG (reversed) Intronic