ID: 1039983562

View in Genome Browser
Species Human (GRCh38)
Location 8:42429010-42429032
Sequence CAGGAAAATGCAGCCTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039983562_1039983568 0 Left 1039983562 8:42429010-42429032 CCCACCAAGGCTGCATTTTCCTG 0: 1
1: 0
2: 0
3: 30
4: 217
Right 1039983568 8:42429033-42429055 TGCATGGGCCCTCAGCAGCCTGG 0: 1
1: 0
2: 0
3: 24
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039983562 Original CRISPR CAGGAAAATGCAGCCTTGGT GGG (reversed) Intronic
900829139 1:4951671-4951693 CAGGAAAATGCAGCATGTGTTGG + Intergenic
901330944 1:8408043-8408065 AAGTAAAAGGCAGCCTTGGGAGG + Intronic
901679996 1:10907429-10907451 CAGGAAGATGCAGCCAGGGTCGG + Intergenic
902134839 1:14296241-14296263 CAGGCAAATGCTGCAGTGGTGGG + Intergenic
903490507 1:23724647-23724669 CAGGAAAATGTACCCATCGTAGG + Intergenic
903709070 1:25308521-25308543 CAAGAAAATAAAGCCTTGATTGG + Intronic
903718045 1:25383899-25383921 CATGAAAATAAAGCCTTGATTGG - Intronic
904615191 1:31745781-31745803 CAGGAAGAGGCAGCCCTGGTGGG - Intronic
905926972 1:41758156-41758178 CCGGGGAAGGCAGCCTTGGTTGG - Intronic
907728722 1:57045192-57045214 CTGGAAAGGGCAGCCATGGTGGG + Intronic
908892990 1:68866306-68866328 CATTAAAATGCTGCCTTGGTGGG + Intergenic
910165863 1:84326640-84326662 TAGAAAACTGCAGCCTTCGTTGG - Intronic
912458441 1:109815516-109815538 CAGGAAACTCCAGCCTTGCTTGG + Intergenic
913322241 1:117596935-117596957 AAGGAAAATGGAGCCTAGGAGGG - Intergenic
914412608 1:147445847-147445869 CTGGGAAAGGCAGCCTTCGTAGG - Intergenic
917447020 1:175115116-175115138 CAGGGAAATACAGCAGTGGTTGG - Intronic
917633072 1:176908943-176908965 CTGGCCAATGGAGCCTTGGTGGG - Intronic
918999447 1:191810953-191810975 CAGAAACATGCAGACTTGTTGGG + Intergenic
920417188 1:205806666-205806688 CAGGAACTTTCAGCCATGGTTGG + Intronic
920544981 1:206808893-206808915 CAGGAAAGGACAGCCTGGGTGGG + Intronic
1065434009 10:25687906-25687928 CAGGGAAGTGAAGCCTTGGAGGG + Intergenic
1067414931 10:46095721-46095743 CAGGAAAAGGCAGGGTTGGTGGG - Intergenic
1067434975 10:46270302-46270324 CAGGAAAAGGCATGGTTGGTGGG - Intergenic
1067835225 10:49634220-49634242 CAGGAGACAGCAGCCGTGGTAGG - Intronic
1069454232 10:68541045-68541067 CAGCCAAATGCAGTATTGGTGGG - Intergenic
1070524342 10:77282287-77282309 GAGGAAAGTGCAGCCTGGCTGGG - Intronic
1070808452 10:79285005-79285027 CAGGAAGATGCAGCCCTTCTTGG + Intronic
1070897992 10:80001808-80001830 CAGGATAGTCCAGCCTTTGTTGG + Intergenic
1072869019 10:99096914-99096936 GAGACAAATGCAGCATTGGTGGG + Intronic
1072968998 10:100000468-100000490 CGGGAAAATGCAGCCTCCGCAGG + Intronic
1073863298 10:107771393-107771415 CAGGAACCTGCAGCATTGGAGGG - Intergenic
1075942004 10:126397959-126397981 CAGGAAAATGCTGTCTCTGTTGG + Intergenic
1076212487 10:128659541-128659563 TTGGATAATGCAGCCTGGGTAGG - Intergenic
1076224952 10:128766687-128766709 AAGGAAAATGCATCCAAGGTAGG - Intergenic
1078696008 11:13632529-13632551 GAGGAAAAAGCAGCATTTGTAGG + Intergenic
1083944930 11:65918567-65918589 CAGGAAAAGGGGGCCTTGGCAGG - Intronic
1085059354 11:73430556-73430578 CAGGAAAATCCAGCCTGGAGAGG + Intronic
1085714038 11:78856004-78856026 CTGGGAAAGGCAGCCCTGGTTGG - Exonic
1089422184 11:118340156-118340178 CATGTTACTGCAGCCTTGGTTGG - Intronic
1090054999 11:123415395-123415417 AAAGAAAAGGCAGCCTTGGCTGG - Intergenic
1091024655 11:132131494-132131516 TACGAAAGTGCAGCCTTGTTGGG + Intronic
1091120284 11:133051823-133051845 CTGGAAAATGCAGGCTTGGGCGG - Intronic
1091244194 11:134077946-134077968 CAAGAAAAAGCATCCTTGGCCGG - Intronic
1097687930 12:62708540-62708562 CAGGAAAATGTTTCCTTGGTGGG + Intronic
1098951923 12:76648550-76648572 CAGGAAGCTGCAGCCTGGGAAGG + Intergenic
1101241943 12:102847890-102847912 CAAGAAAAGGCAGCGTTGTTTGG + Intronic
1101256743 12:102985211-102985233 TAGCAAAATGCAGCATTGGGCGG - Intergenic
1101494754 12:105243235-105243257 AAGAAAAATGCATCCTTGGCCGG + Intronic
1102187898 12:110964258-110964280 CAGGTATATGCAGCATTGGTGGG - Intergenic
1104074740 12:125379059-125379081 CCTGAAAATGAAGGCTTGGTAGG - Intronic
1104339936 12:127938870-127938892 CAGGAAAATTCAGCTTTCTTCGG - Intergenic
1104431191 12:128717683-128717705 CAGATAAATGCAGCCCTGGCTGG + Intergenic
1104951892 12:132444881-132444903 GAGGGAAACGCAGCCTTGGCCGG - Intergenic
1107813845 13:44226256-44226278 CAGGAAATTGCAGTCTTAGGAGG + Intergenic
1107834104 13:44399755-44399777 GAAGAAAATCAAGCCTTGGTTGG + Intergenic
1108498737 13:51049541-51049563 TAGGAAAATGCAGACTGGGCTGG + Intergenic
1109062929 13:57642278-57642300 CAGCTAAAAGCAGCCTTTGTAGG + Intronic
1110356520 13:74573873-74573895 CAGCCTAAGGCAGCCTTGGTGGG + Intergenic
1110379998 13:74839412-74839434 TAGGAAATTGCAGCCATGTTTGG + Intergenic
1110680239 13:78302330-78302352 AAGGCGAATGCAGCCTTGTTAGG - Intergenic
1110788146 13:79558483-79558505 CAAGAAAGTCCAGCCTGGGTAGG + Intergenic
1112870914 13:103969552-103969574 CAGGAAAATGCAACGTGTGTTGG + Intergenic
1113599296 13:111557411-111557433 CATGAAAATGCAGACTTTGGAGG - Intergenic
1114752438 14:25219999-25220021 CAGGAGAAAGCAGCCCTGGTTGG + Intergenic
1116966452 14:51020477-51020499 CAGGAAACTCCAGCCTGGGCAGG + Intronic
1119125979 14:72126795-72126817 AAGGAAAACGCAGCTTTTGTTGG + Intronic
1119191896 14:72688591-72688613 TACTTAAATGCAGCCTTGGTAGG - Intronic
1119230498 14:72975603-72975625 CAGGAAGTCACAGCCTTGGTGGG + Exonic
1119331215 14:73795413-73795435 CAGGAAAAAGCACCCTGTGTGGG - Intergenic
1119859420 14:77925526-77925548 GAGGAGAATGTAGACTTGGTTGG + Intronic
1120123629 14:80713928-80713950 TAGGAAACTGCAGCATTGGATGG - Intronic
1121283976 14:92720309-92720331 AAGGAAAACGCAGCCTTTGGAGG + Intronic
1122119845 14:99546381-99546403 CAGGGAAATCCAGGCTTGGCTGG + Intronic
1124350996 15:28955576-28955598 CAGGGAAATGCATCTTTTGTGGG + Intronic
1125513741 15:40306738-40306760 AAGGGAAATGAAGGCTTGGTGGG - Intronic
1126189083 15:45860865-45860887 CAGGAAACTGCAGCCTAGCAAGG - Intergenic
1127539078 15:59919586-59919608 GATGAAAATGAAGCCTTGGGAGG + Intergenic
1127662626 15:61114438-61114460 CAGAAAAATGCAGTGTTGTTAGG + Intronic
1128916220 15:71565288-71565310 CAGGAAAATGGACACTTAGTAGG + Intronic
1129003519 15:72353408-72353430 CAGGAAAATCCAGAATTTGTAGG - Intronic
1129180231 15:73869622-73869644 CAGTAAAAGGCAGCTGTGGTGGG + Intergenic
1136652437 16:31684332-31684354 CAAAACAATGCAACCTTGGTCGG - Intergenic
1138602214 16:58062882-58062904 CAGGAAAATGCAGCCTACAGGGG - Intergenic
1138901245 16:61273685-61273707 CAGGAAAATGCTGCTTTTATTGG + Intergenic
1140254432 16:73322870-73322892 CAGCAAACTGCAGCCTGGATAGG + Intergenic
1141879631 16:86849244-86849266 CAGGAAAAGGCAGGCTGGGATGG - Intergenic
1143890188 17:10096914-10096936 AAGGAAATTGCAGCCTCGGATGG - Intronic
1144740035 17:17576631-17576653 CAGGAGAACGCTGCCATGGTGGG - Intronic
1144866563 17:18339350-18339372 CAGAATAATGCAGCCTTGTGAGG + Intronic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1152987361 18:332929-332951 CTGGAAATTGCAGGCTTGTTGGG - Intronic
1153446657 18:5180337-5180359 GAGAAAACAGCAGCCTTGGTGGG - Intronic
1155743137 18:29315249-29315271 CAGGATACTGTAGCCTTGTTAGG + Intergenic
1156743620 18:40363150-40363172 CAAGAAGGTGCAGCCTAGGTGGG - Intergenic
1157135015 18:45045486-45045508 CAGGAAAATGTGCCCTTGTTCGG - Intronic
1157788394 18:50507371-50507393 CAGGAAACAGCAGCCTAGGCAGG - Intergenic
1159812838 18:73037186-73037208 CAGGAAAAGGCATGCATGGTAGG + Intergenic
1160554458 18:79716902-79716924 CAGGGATAGGCAGCCATGGTGGG - Intronic
1161669236 19:5595656-5595678 CAGTAAAATGCAAACTTGGAGGG - Intronic
1162458029 19:10797592-10797614 CTGGAAAATTCAGCCTCGGCAGG + Intronic
1166666375 19:44682808-44682830 AAGGAAATTGCAGCCTTGGGAGG - Intronic
1167273553 19:48520793-48520815 CAGAAAAAAGCAGCTTTGGTGGG - Intergenic
925999490 2:9318964-9318986 CAGGAAAATACACCCTTGCTAGG - Intronic
927134786 2:20088832-20088854 CAGGAAACCTCAGACTTGGTAGG + Intergenic
927399762 2:22697327-22697349 AAGGAAAATGCAGAATTGCTGGG - Intergenic
927466703 2:23342108-23342130 CAGGAAAATGCAGTGATGGGAGG - Intergenic
927742199 2:25581506-25581528 CAGAAAAATGCAGTCTAGCTAGG - Intronic
928015513 2:27653317-27653339 AAGTAAAATGCAACCTTGTTTGG + Exonic
928219591 2:29392558-29392580 CTGGAATATGCAGGCTTGTTGGG + Intronic
932968282 2:76504450-76504472 CATGAAAATATAGCCTTGGCCGG - Intergenic
933520893 2:83371821-83371843 TAAAAAAATGCAGCCATGGTTGG + Intergenic
935816071 2:106847055-106847077 TTAGAAAATGTAGCCTTGGTTGG - Intronic
937243054 2:120474786-120474808 CAGGCAAAGGAAGCCTGGGTGGG - Intergenic
938135601 2:128754037-128754059 CAGGAGAATGCAGCCCTGGAAGG - Intergenic
940768939 2:157819777-157819799 AAGGAAAATGGGGCCTGGGTGGG - Intronic
940940553 2:159555389-159555411 TATGAAAATGTAGCCTTGGTAGG - Intronic
941704215 2:168640776-168640798 CAGGAAAACTCAGCCTTCTTTGG - Intronic
943456638 2:188116159-188116181 CAGGAAAAAGAAGTCTTGATTGG - Intergenic
945069932 2:205979684-205979706 CTGGAAAATCCAGCCTGGGAAGG + Intergenic
947058256 2:226132778-226132800 CAGGATGGTGAAGCCTTGGTGGG - Intergenic
947278133 2:228417682-228417704 CAGGAAAATGAAGCTCAGGTTGG + Intergenic
948107715 2:235428413-235428435 CAGGAGAATGCTTCCTTGGTTGG - Intergenic
948547077 2:238740344-238740366 AAGGTTAATGCAGCCTTGGTTGG - Intergenic
1169543687 20:6629391-6629413 CAAGAAAATGCAGCCATGGCAGG + Intergenic
1171299789 20:24050252-24050274 CAGGAACATGCAGCCCTGTTGGG - Intergenic
1171454083 20:25257078-25257100 CAAGAAAATGCAGACTTGAATGG - Intronic
1173321770 20:41993800-41993822 CTGGAAAATGCAGCCTGTATGGG + Intergenic
1173923840 20:46765766-46765788 CAGGAAAGGGCAGCCTTGAAGGG + Intergenic
1174087721 20:48020762-48020784 CCGGGAAGGGCAGCCTTGGTGGG + Intergenic
1174179225 20:48664577-48664599 CAGGAAAATGGCACCTTGGCGGG + Intronic
1174716140 20:52761037-52761059 CAGCAAAAGGCATCCTTGATGGG - Intergenic
1175039840 20:56038425-56038447 CAGGAAAATACAGGCTTTGAGGG - Intergenic
1175757332 20:61538128-61538150 CTGGAAAATACAGCTTTGGGTGG - Intronic
1176430055 21:6569894-6569916 CAGCCACATGCAGCCTTGGCTGG - Intergenic
1176431628 21:6579680-6579702 CAGGAAAATGGAGCCACGGAAGG - Intergenic
1177122752 21:17158232-17158254 ATGGAAAATACAGCCTTCGTGGG + Intergenic
1178563262 21:33659017-33659039 CAGGAAACTGCAGGATTGGAGGG + Intronic
1179705449 21:43177356-43177378 CAGCCACATGCAGCCTTGGCTGG - Intergenic
1179707022 21:43187142-43187164 CAGGAAAATGGAGCCACGGAAGG - Intergenic
1180908955 22:19435044-19435066 CAGGAGAAAGCATCCTTGGGTGG + Intronic
1181772854 22:25139272-25139294 CAGGAAGATGCAGGCTTGGCAGG + Intronic
1182529633 22:30945179-30945201 TAGGAAAATATAGCCTGGGTTGG - Intronic
1184371122 22:44082739-44082761 CAGAAAAATGAATCCTTTGTGGG - Intronic
1184429801 22:44435567-44435589 CAGGAGACCGTAGCCTTGGTGGG - Intergenic
949838626 3:8296286-8296308 CAGGAGAATGCAGCCTGTGATGG - Intergenic
950659178 3:14456101-14456123 AGGGAAAATGAAGGCTTGGTGGG - Intronic
950901233 3:16499583-16499605 CAGGAATCTGCAGCTTTGGCAGG - Intronic
952258290 3:31714297-31714319 CTGGACACTGCAGCCTTGCTGGG + Intronic
954676726 3:52319964-52319986 CAGGAAACTGCAGGGTTGCTGGG - Intronic
956793688 3:72699895-72699917 CTGGATAACGCAGCCTTTGTTGG - Intergenic
960516121 3:118604521-118604543 CAGGAATATCCATCCTTGCTGGG + Intergenic
961989631 3:131174093-131174115 TATGAAAATACAGCCTTGATAGG + Intronic
962365045 3:134773182-134773204 CAGGATCTTGCAGCCTTGGATGG - Intronic
962863145 3:139423248-139423270 CAGGAAAAGGCAGCCTAGCAAGG + Intergenic
963028225 3:140941546-140941568 CAGGAGAGTGCAGCCGTGATTGG + Intergenic
964078587 3:152723170-152723192 CAAGAAAATGCAGAATTGGTAGG + Intergenic
965559441 3:170047256-170047278 CAGGACAGTGCAGGCTTGGGGGG - Intronic
965619712 3:170630493-170630515 GAGGAAAGTGCAGCATTAGTAGG - Intronic
966932948 3:184687541-184687563 CAGGGAAATGGAGCCTGGGCTGG - Intergenic
968754462 4:2408262-2408284 CAGGGAAATGCTGGCTTGGTAGG - Intronic
969102322 4:4778419-4778441 CTGGAAAATGCAGTCTAGCTGGG + Intergenic
970354687 4:15240133-15240155 AAGGGAAATTCAGCTTTGGTAGG - Intergenic
971261108 4:25057642-25057664 CAGGAAGCTGGAACCTTGGTGGG - Intergenic
974233454 4:59148138-59148160 TAGAAAAATGCAGCCGGGGTTGG - Intergenic
975087265 4:70356927-70356949 CAGGAAATTGCAGTGTTAGTAGG - Intergenic
975815324 4:78210935-78210957 AAGGGAAATGAAGCCTTGGTGGG - Intronic
978385873 4:108175086-108175108 CAGGAAATGGCTCCCTTGGTGGG - Intergenic
978839154 4:113189056-113189078 CATGAAAAAGAAGCCTTGTTGGG + Intronic
981028723 4:140102418-140102440 CAGGAGAAACCAGCCTTGCTTGG - Intronic
981870212 4:149476776-149476798 TAGGAAAATGCACACTTGGAGGG + Intergenic
982013123 4:151126048-151126070 CAGGTATGTGCAGCCTTTGTCGG - Intronic
983234123 4:165159709-165159731 CACAAAGATGCAGCCATGGTGGG - Intronic
986054761 5:4125654-4125676 CAGGAAAATGAATCAATGGTGGG + Intergenic
989011073 5:36874259-36874281 CAAGAAAAGACAGCCTTGATAGG - Intergenic
991353853 5:65747724-65747746 CAGGAAAATGGACCCTAGGAAGG + Intronic
991714240 5:69436788-69436810 CTGGGAAATGCAGGCTTGTTGGG + Intronic
993533724 5:89055165-89055187 CAAGAAAATGCCGCTTTGGGTGG + Intergenic
993816558 5:92555315-92555337 AAGGAAAATGCAGCCAGGCTTGG - Intergenic
995390542 5:111635876-111635898 TTTGAAAATGCAGCCTTGCTTGG - Intergenic
995796595 5:115947609-115947631 CAGGAGAATGCCCACTTGGTCGG + Intergenic
999121084 5:149209847-149209869 CAGGAAAATGCTGCCCAGGGTGG + Intronic
999243017 5:150138431-150138453 CATGTGAATGCAGCCCTGGTAGG - Intronic
1000199107 5:158989911-158989933 CAGGAACTTGCAGTCTTGGCAGG + Intronic
1000227611 5:159281216-159281238 CAGGAAATTACAGGGTTGGTGGG - Intronic
1001379127 5:171291312-171291334 CTAGAAAATGTAGCCTAGGTTGG + Intronic
1001427600 5:171633925-171633947 CAGGAGGATGGAGCCTGGGTTGG - Intergenic
1001459117 5:171893629-171893651 CAGGAAAATGCTGATTTAGTAGG + Intronic
1003126818 6:3362473-3362495 CAGGAAACAGTATCCTTGGTGGG - Intronic
1005797380 6:29380064-29380086 CAACAAAAGGCAGCCTAGGTAGG + Intronic
1008293047 6:49741298-49741320 CAGGAAAAAACAGCATTGGGAGG - Intronic
1010734439 6:79427855-79427877 AACCAAAATACAGCCTTGGTGGG + Intergenic
1010758937 6:79699419-79699441 CAAGAAAATTCACCCTTGGCAGG - Intronic
1011389068 6:86831471-86831493 CAGGAAGATGCACCCTTCTTGGG - Intergenic
1011657165 6:89562370-89562392 CAGGAAAATGCTTGCTTTGTGGG - Intronic
1012700694 6:102453058-102453080 CTGGAAAATACAGACTTGGGGGG - Intergenic
1012948073 6:105488946-105488968 CAGGAAAATGCTGCCACGGTGGG - Intergenic
1013589313 6:111606779-111606801 CAGGAAAATGCAGCCAGAGGAGG - Intergenic
1017252221 6:152292813-152292835 TAGGAAAATGCTGCCTGGCTGGG - Intronic
1017954121 6:159163985-159164007 CAGAAAAATGCAGCCTGGGAAGG + Intergenic
1018033806 6:159865301-159865323 CAGAAAAATGGAGAATTGGTTGG - Intergenic
1018930771 6:168239022-168239044 TAGCAAATAGCAGCCTTGGTGGG + Intergenic
1020220990 7:6236857-6236879 CAGAAAAATGGAGACTTGGCCGG - Intronic
1020811031 7:12850529-12850551 CAAGAAAATGCTGCTTTGATGGG - Intergenic
1024848937 7:53686535-53686557 CATGAAAGTGCAGCCTGAGTTGG + Intergenic
1028674522 7:93443198-93443220 AAGGAAAATGAAGCCAGGGTAGG + Intronic
1028929719 7:96398912-96398934 CAGAAAAATGTTGCCTTGATTGG + Intergenic
1029612982 7:101637190-101637212 CAGGAAAAGGCATCCCTAGTTGG - Intergenic
1029645878 7:101855434-101855456 AAGGAAAATGAGGCCTAGGTAGG + Intronic
1031101664 7:117487908-117487930 CAAGAAAATGAAGCCTATGTTGG + Intronic
1031228000 7:119065973-119065995 TAGTAAAATGAAGCATTGGTAGG - Intergenic
1031509660 7:122634168-122634190 CAGGATAATGCTGGCTTTGTAGG + Intronic
1031665411 7:124477234-124477256 CCGGAAAATGCAGTCATGGTGGG - Intergenic
1033590260 7:142802847-142802869 CAGGAGAAAGCAGCATTGGGTGG - Intergenic
1034368466 7:150572207-150572229 CAGGAAACAGCATCCTTGGCCGG + Exonic
1034455855 7:151169351-151169373 TAGGAAGATGCAGTCTAGGTAGG + Intronic
1034833634 7:154331583-154331605 CAAGAAGATGCAGCTTTGGAAGG + Intronic
1039849234 8:41348035-41348057 CAGTGAAATGCAGCCACGGTGGG + Intergenic
1039983562 8:42429010-42429032 CAGGAAAATGCAGCCTTGGTGGG - Intronic
1040079204 8:43270708-43270730 CAGGAAAAGGCAACTTTGGAGGG - Intergenic
1041245631 8:55885876-55885898 GAGGAAAACGCAGCATTGGGTGG - Intronic
1041380377 8:57248440-57248462 CAGGAAAATAAATCCTTGCTAGG + Intergenic
1045256954 8:100533921-100533943 CAGAGAAGTGCAGCCTGGGTGGG - Intronic
1047036189 8:120941042-120941064 ACTGACAATGCAGCCTTGGTTGG + Intergenic
1047225427 8:122952369-122952391 CAGGACAACTCAGCCTGGGTCGG - Exonic
1047357951 8:124141119-124141141 GTGGAAAAAGCAGCTTTGGTAGG - Intergenic
1048256152 8:132906658-132906680 AAGGAAAGTGGAGCCGTGGTGGG - Intronic
1048447215 8:134500313-134500335 CAAGAAGCTACAGCCTTGGTTGG - Intronic
1048662677 8:136623316-136623338 CAGGAAAATGTAGCAGTGGCTGG - Intergenic
1048804737 8:138229551-138229573 GTGGAAAAGGCAGCCTTTGTGGG + Intronic
1049490395 8:142896328-142896350 CTTCATAATGCAGCCTTGGTAGG + Intronic
1050090479 9:2013670-2013692 CATGAAAATGCTGCCCTAGTGGG + Intergenic
1050244792 9:3677488-3677510 CAAGGAAATGCAGCCTTTTTGGG + Intergenic
1051344925 9:16143171-16143193 GAGGAAAATGCAGCTTTCTTGGG + Intergenic
1054927685 9:70604601-70604623 GAGGAAGCTGCAGCCTTGCTGGG + Intronic
1054977833 9:71169371-71169393 CTGAGAAATGCAGCCTTGGAAGG + Intronic
1058123661 9:101167299-101167321 TTGGAAAATGCAGCCTTGCTTGG + Intronic
1058212099 9:102181776-102181798 CAGAGAAATGGAGCCATGGTTGG - Intergenic
1060477807 9:123999178-123999200 CAGGAAACTGCAGCCCTGGCGGG + Intergenic
1185526422 X:783808-783830 CATGAAAAAGAAGGCTTGGTTGG - Intergenic
1185635494 X:1548961-1548983 CAGGACGATGGAGCCTTGGGTGG - Intergenic
1185727538 X:2434326-2434348 TAAGAAAATGCAGTCTTGGTGGG - Intronic
1188981445 X:36730671-36730693 TAGGAAAAGGCAGCCTAGGGGGG - Intergenic
1189299450 X:39942048-39942070 CAGCCTAATGCAGCCTTGGGAGG + Intergenic
1190777518 X:53564889-53564911 CTTCAAAATGCAGCCTTGTTTGG - Intronic
1192169575 X:68845929-68845951 CAGGAAAATCCAGCCATTGTGGG - Intergenic
1194165308 X:90507801-90507823 CAGGAATCTTCACCCTTGGTTGG - Intergenic
1199623375 X:149718414-149718436 GTGAAAAATGCTGCCTTGGTGGG + Intergenic
1200511577 Y:4085611-4085633 CAGGAATCTTCACCCTTGGTTGG - Intergenic