ID: 1039984572

View in Genome Browser
Species Human (GRCh38)
Location 8:42436709-42436731
Sequence CTGGCCGGTGACGGAGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039984572_1039984578 -3 Left 1039984572 8:42436709-42436731 CCTGCACCTCCGTCACCGGCCAG 0: 1
1: 0
2: 1
3: 13
4: 163
Right 1039984578 8:42436729-42436751 CAGCCCTTCCCTGGAAGCCCAGG No data
1039984572_1039984584 14 Left 1039984572 8:42436709-42436731 CCTGCACCTCCGTCACCGGCCAG 0: 1
1: 0
2: 1
3: 13
4: 163
Right 1039984584 8:42436746-42436768 CCCAGGTCGCACTGCCATCCTGG No data
1039984572_1039984586 17 Left 1039984572 8:42436709-42436731 CCTGCACCTCCGTCACCGGCCAG 0: 1
1: 0
2: 1
3: 13
4: 163
Right 1039984586 8:42436749-42436771 AGGTCGCACTGCCATCCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039984572 Original CRISPR CTGGCCGGTGACGGAGGTGC AGG (reversed) Intronic
901787946 1:11637174-11637196 CTGGCCAGTGAGAGAGGAGCTGG - Intergenic
901853188 1:12029045-12029067 CTGGCTGGTGATGGAAGAGCTGG - Exonic
902606940 1:17574023-17574045 CAGGTCGGTGAGGGAGGAGCTGG + Intronic
902955947 1:19924121-19924143 CTGAACGGTGACGGAGGTGCAGG - Intergenic
904334701 1:29789485-29789507 GTGGCAGCTGAGGGAGGTGCAGG - Intergenic
905031241 1:34885715-34885737 CTGGGCGGTGATGGAGATGCGGG + Exonic
905647209 1:39633045-39633067 CTGGCCGGCGGCGGCGGGGCTGG + Intronic
906518437 1:46453160-46453182 CGGCCCGGTGACGGAGGCGCAGG - Intergenic
907429764 1:54405403-54405425 CTGGGCAGCGACGGTGGTGCCGG - Intronic
907751870 1:57270674-57270696 CTGGACACTGACGTAGGTGCTGG + Intronic
913243960 1:116855341-116855363 GTGGCTGGTGACCGTGGTGCTGG - Intergenic
915246244 1:154558309-154558331 CTGGCTGGGGCCGGAGGGGCCGG - Exonic
918044825 1:180935482-180935504 CTGCCCGGTGCCGGCGGTGCCGG - Exonic
922440581 1:225652805-225652827 CTGGCCGCCGAAGGAGGAGCCGG - Exonic
923506565 1:234610090-234610112 CTGGCCGCTGACGCTGGCGCTGG - Intergenic
923900252 1:238318477-238318499 CTGGCCAGTGTGGGAGGAGCAGG - Intergenic
1063375626 10:5552692-5552714 CTGGCGGGTGGTGGAGATGCAGG - Intergenic
1066293614 10:34035496-34035518 CTGCCCGGGGCCGGTGGTGCTGG - Intergenic
1068981888 10:63071247-63071269 CTGGCAGGGGCAGGAGGTGCAGG + Intergenic
1073206502 10:101772207-101772229 CTGGCAGGTGTCTGAGGTTCTGG - Intronic
1073492026 10:103859019-103859041 GTGGCAGGTGACAGAGGTGCTGG - Intergenic
1076598275 10:131639194-131639216 CTGGCCGGCAATGGAGGTGCTGG - Intergenic
1083329652 11:61891602-61891624 CTGGCCGGGGGCGGGGGGGCAGG - Intronic
1083554295 11:63613863-63613885 CTCGCAGCTGACAGAGGTGCGGG + Intronic
1083764577 11:64835803-64835825 CCGGCAGGTGACGCAGCTGCAGG - Exonic
1083904278 11:65660042-65660064 TTGGCCAGTGAGGGAGATGCAGG + Intronic
1083936625 11:65872902-65872924 CTGGCCGGGGGCGGAGAAGCGGG - Exonic
1083998912 11:66285469-66285491 GTGGGTGGTGATGGAGGTGCTGG - Exonic
1091771185 12:3152298-3152320 GTGGCAGGTGAGGGAGGAGCTGG - Intronic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1096829083 12:54300718-54300740 CTGGGGGGTGAAGGAGGTGAGGG - Intronic
1103700106 12:122844837-122844859 CTGGCCTGTGTCAGAGCTGCTGG + Intronic
1103721648 12:122978581-122978603 CTGGCCGGTGGCAGAGGAGGGGG + Intronic
1103960907 12:124608763-124608785 CTTGCTGGTCACGGAGCTGCAGG + Intergenic
1104636340 12:130440087-130440109 ATGCCCGGGGACGGTGGTGCAGG - Intronic
1104636353 12:130440127-130440149 ATGCCCGGGGACGGTGGTGCAGG - Intronic
1104636366 12:130440167-130440189 ATGCCCGGGGACGGTGGTGCAGG - Intronic
1104636379 12:130440207-130440229 ATGCCCGGGGACGGTGGTGCAGG - Intronic
1105018713 12:132802356-132802378 GTGGCCGGACACGGGGGTGCAGG + Intronic
1107020013 13:35741662-35741684 CTGGCCGGTGGCGGATGCGCTGG + Intergenic
1113778711 13:112963543-112963565 CTGGCTGGAGACACAGGTGCAGG - Intronic
1115269837 14:31539492-31539514 GAGGCAGGTGACGGAGGTGAGGG + Intronic
1118008897 14:61590207-61590229 CAGACCTGTGACAGAGGTGCAGG + Intronic
1121111512 14:91316230-91316252 CTGGCCTGTGAGGGAGATGGTGG - Intronic
1121625478 14:95382862-95382884 CTGGGCTGTGGCAGAGGTGCTGG - Intergenic
1122602901 14:102930147-102930169 CTCGCCTGCGACGGAGGGGCCGG - Exonic
1122613662 14:103002253-103002275 CTGGCCCGTGACTGCGGGGCCGG - Intronic
1122945371 14:105006203-105006225 CTGGCCTGTGACAGCTGTGCTGG - Intronic
1124175402 15:27419188-27419210 CTGGAAGGTGCAGGAGGTGCAGG - Intronic
1128173290 15:65531190-65531212 CTGGGCGCTGCCGGAGGTGGGGG + Intronic
1128716467 15:69912242-69912264 CTGGAGGGTGAGTGAGGTGCAGG + Intergenic
1129667692 15:77588588-77588610 CAGGCCGGTTACTGAGGTCCTGG + Intergenic
1132256567 15:100381678-100381700 TTGGCAGGTGAAGGAGGTGAAGG - Intergenic
1132346273 15:101111019-101111041 CTGGACTGTGAGGGAGGTGCCGG + Intergenic
1132683564 16:1153321-1153343 CGGGCCGGGGGCGGAGGCGCTGG + Exonic
1137645025 16:50066242-50066264 CGGGCCGGCGGCGGAGCTGCTGG + Exonic
1138654852 16:58485355-58485377 ATGGCCTGTGACGGAGGTGGTGG - Intronic
1141928250 16:87183360-87183382 GTGGCAGGTGAAGGAGGAGCAGG - Intronic
1142232480 16:88906285-88906307 ATGGCCTGTGGCCGAGGTGCAGG - Intronic
1142235658 16:88921412-88921434 CTGGCTGGTGACGGATGGGGTGG + Intronic
1142347963 16:89565951-89565973 CTGCCCGGTGGAGGAAGTGCAGG + Exonic
1144039406 17:11395797-11395819 CTGGCCGGGCACGGTGGTTCAGG - Intronic
1144739309 17:17572369-17572391 GTGGCTGGGGACGGTGGTGCAGG - Intronic
1146524528 17:33554769-33554791 CTGGCCGGGGACTGAGCTGGGGG + Intronic
1147429557 17:40363067-40363089 AGGGCCGGTGGCGGAGGTGGCGG + Exonic
1147805329 17:43126922-43126944 CTGCCCGGGGCCGGGGGTGCGGG - Intergenic
1148118232 17:45190658-45190680 CTGCCTGGTGAGGGAGTTGCTGG + Intergenic
1148874803 17:50680616-50680638 CTGGCCGGGGAGGGAGGTGAAGG - Intronic
1149656173 17:58310648-58310670 TTGGCCAGTGAGGGAGCTGCGGG + Exonic
1151569819 17:74920710-74920732 CTGGCTGGGGATGGAGGTGGAGG + Intronic
1152393800 17:80019400-80019422 GTGGCGGGTGATGGAGGAGCCGG - Intronic
1159909073 18:74126719-74126741 CTGGCTTGTGCCTGAGGTGCTGG - Intronic
1160426781 18:78783297-78783319 CTGGCTGGAGACCCAGGTGCAGG + Intergenic
1160560123 18:79750935-79750957 CAGGCCGGGGAGGGAGGGGCTGG + Intronic
1160560194 18:79751140-79751162 CAGGCCGGGGAGGGAGGGGCTGG + Intronic
1160730868 19:641081-641103 CTGGACGGTGATGGGGGTGAGGG + Intronic
1160803270 19:980039-980061 CTGGCTGGGGAGGGAGGTGGGGG - Intergenic
1160902233 19:1434290-1434312 CTGGTCTGCGACGGAGGGGCAGG + Intronic
1163151646 19:15418606-15418628 CAGGCCAGGGACGGAGGTGGTGG + Intronic
1163290372 19:16375910-16375932 CTGACAGGTGGCCGAGGTGCAGG + Intronic
1163323227 19:16586710-16586732 CTGGCCGGACACCGAGGTGGGGG - Intronic
1163509776 19:17727647-17727669 CTGCCGGGGGACGCAGGTGCCGG - Exonic
1163521560 19:17794968-17794990 ATGGCCGGGGAGGGAGGAGCCGG + Intronic
1163830674 19:19545832-19545854 CTGGAAGGTGACGGCTGTGCCGG - Exonic
1166100860 19:40570634-40570656 GTGGGCGGTGGCGGAGGCGCGGG - Exonic
1166753963 19:45179332-45179354 GAGGCCGGAGACGGTGGTGCCGG + Exonic
925886467 2:8397519-8397541 CAGGCCGGTGAGGTAGCTGCTGG - Intergenic
926299603 2:11593109-11593131 CTCACCGGTGACGGCGATGCAGG - Exonic
927141839 2:20136217-20136239 CTGGGCTAGGACGGAGGTGCTGG + Intergenic
927561575 2:24077200-24077222 CGGGCAGGTGCCGGAGGTGGTGG + Intronic
927598179 2:24415873-24415895 CTAGCCGGTCATGGTGGTGCAGG + Intergenic
929650726 2:43677789-43677811 CTGCCCGGTGCGGGAGGTGAGGG - Intronic
932779216 2:74549496-74549518 CCTGCCCGTGACGGAGGGGCTGG - Exonic
935341194 2:102061339-102061361 CTGGCAGGGGAGGCAGGTGCTGG - Intergenic
935617340 2:105100299-105100321 CTGCCAGGTGTGGGAGGTGCTGG + Intergenic
935634839 2:105242365-105242387 CTGGACGCTGGTGGAGGTGCCGG + Exonic
937322511 2:120969435-120969457 CTGGCCTCTTCCGGAGGTGCTGG - Intronic
938792975 2:134692962-134692984 CTGGAACGTGACTGAGGTGCTGG - Intronic
942797346 2:179836931-179836953 CTGGCTGGTGACTGGGGTGCTGG - Intronic
944495877 2:200306886-200306908 CCGGCCCGGGACGGAGGAGCCGG + Intronic
944871679 2:203918474-203918496 CTGGCTGGAGACGGAAGGGCGGG - Intergenic
948301727 2:236912588-236912610 CAGGTCGGTGTCAGAGGTGCTGG - Intergenic
948788729 2:240366192-240366214 CTGGCCGGGGAGGGTAGTGCTGG - Intergenic
948894352 2:240921377-240921399 CTGGCAGCTCACGGATGTGCTGG - Intronic
1170857800 20:20073518-20073540 CTGACTGGTGAGGGTGGTGCTGG - Intronic
1171207761 20:23294486-23294508 CTGGCAGGTGAGGGTGGGGCTGG - Intergenic
1172009119 20:31836262-31836284 CTGGCAGGTGGCGGACGGGCAGG - Intergenic
1172021902 20:31920516-31920538 CTGAGCGGTGACGATGGTGCAGG + Intronic
1173873793 20:46357367-46357389 CTGGCAGGAGAGGGAGCTGCGGG + Intronic
1178021990 21:28419059-28419081 CTGTCCTGTGAAGGAGGTGTGGG + Intergenic
1179812802 21:43883250-43883272 CTGGCTGATCACGGAGGTCCAGG - Intronic
1179884098 21:44306129-44306151 GGGGCCGGTGTGGGAGGTGCCGG + Intronic
1180800965 22:18631740-18631762 CTGGATGGTGGCGAAGGTGCAGG - Intergenic
1180852198 22:19027297-19027319 CTGGACGGTGAAGAAGGTGCAGG - Intergenic
1183308682 22:37097759-37097781 CTGTCCTGTAACGGAGGGGCAGG + Intronic
1183650838 22:39152479-39152501 CGGGCCGGGGGCGGAGCTGCGGG + Exonic
1183656710 22:39189988-39190010 ATGGCAGGTGACTGAGGTACGGG - Intergenic
1185367417 22:50443294-50443316 CTGGGCCGTGACGACGGTGCAGG - Intronic
950033433 3:9867008-9867030 CTGCGCGGTGAGGGAGGTGTGGG + Exonic
950496816 3:13338810-13338832 CTGGCAGGTTGGGGAGGTGCTGG - Intronic
954318036 3:49811887-49811909 GTGGCCGGCCATGGAGGTGCTGG + Exonic
956598567 3:70994720-70994742 CTGGCAGGCGACGGGGGTGGAGG - Intronic
956738674 3:72258475-72258497 CTGGCTGGCGATGGAGCTGCTGG - Intergenic
960622261 3:119648289-119648311 CTGGCCCGGGTAGGAGGTGCAGG + Exonic
961366990 3:126406440-126406462 CTGGTCGGTGCCTGAGGGGCAGG - Intronic
961405938 3:126679561-126679583 CTGGCCGGCCCTGGAGGTGCTGG - Intergenic
961986135 3:131137268-131137290 CTGGCAGGTCAGGCAGGTGCTGG - Intronic
962740816 3:138361559-138361581 TGGGCAGGTGAGGGAGGTGCTGG + Intronic
962820636 3:139044655-139044677 CTGGCAGGGGACGTGGGTGCGGG + Exonic
963445734 3:145405081-145405103 CTGGCCAGTGATATAGGTGCAGG + Intergenic
963939966 3:151087446-151087468 CTGGCCAGGGACGAAGGTGAGGG + Intronic
966868571 3:184276055-184276077 ATGGCTGGTGACGGCGGGGCCGG + Intronic
966878278 3:184335915-184335937 CGGGCCGGTGACGTAAGCGCGGG - Intronic
966913645 3:184573123-184573145 ATGGCCGGTGGCACAGGTGCAGG - Exonic
968222167 3:196947468-196947490 CTGGGAGGTGTAGGAGGTGCCGG + Exonic
968868542 4:3228705-3228727 GTGGGTGGTGACGAAGGTGCAGG - Exonic
968962275 4:3751689-3751711 CTTGCTGGTGACGAAGGTGGCGG - Intergenic
969151948 4:5177245-5177267 CTGCCCTGTGAAGAAGGTGCCGG - Intronic
969605234 4:8199181-8199203 AGGGCCGGTGACGGAGAGGCAGG - Intronic
978841924 4:113224468-113224490 CTGGCCAGTTACAGAGGTTCAGG - Intronic
979674679 4:123398345-123398367 CTGGCCGGTGGCGGCGGGGGCGG + Intronic
982504276 4:156197920-156197942 CTAGCCTGTGACAGAGCTGCAGG + Intergenic
984728650 4:183045179-183045201 CTGCCTGGTGCCGGCGGTGCCGG - Intergenic
999144216 5:149381844-149381866 CAGGCCTGAGAGGGAGGTGCAGG + Intronic
1002256272 5:177960576-177960598 CTGGCCTGAGACGGCTGTGCCGG + Intergenic
1002795267 6:466521-466543 CTGGCCAGGGAGGGAGGTGCAGG + Intergenic
1003869033 6:10387354-10387376 CTGGCCTGTGACTGCGATGCTGG - Intergenic
1006393771 6:33773775-33773797 CTGGCCTGGGAAGGAGGGGCTGG - Intronic
1006810270 6:36815939-36815961 CTGCCTGGTGAGGGAGGGGCAGG + Intronic
1006909389 6:37554386-37554408 CTGGTCTGTGACTGAGGTGGTGG + Intergenic
1007109441 6:39304479-39304501 CTGGCAGGTGAGGGGGCTGCTGG - Exonic
1012245746 6:96924371-96924393 GGGGCCGGCGACGCAGGTGCCGG + Intergenic
1014122358 6:117740058-117740080 CTGGCTGGTGGCGGCGGTGGGGG - Intergenic
1014344390 6:120249728-120249750 CTGGTTAGTGAGGGAGGTGCAGG + Intergenic
1016328240 6:142927060-142927082 CCGGCCGGGGACGGAGGCGCCGG - Intronic
1017131727 6:151113625-151113647 CTGGAGGGTGAGGGAGGTGGTGG + Intergenic
1017683099 6:156883746-156883768 GTGGCAGGTGCTGGAGGTGCTGG + Intronic
1017789214 6:157781280-157781302 CAGCTCGGTGACGGAGGTGAAGG - Intronic
1020330802 7:7015137-7015159 CTGGCCTGTGGCAGATGTGCAGG - Intergenic
1021600826 7:22361664-22361686 CTGGCTGGTGGTGGATGTGCCGG - Intergenic
1027200490 7:76061046-76061068 CTGGACGGAGACTGAGCTGCTGG + Intronic
1034345116 7:150381238-150381260 CTGGCCGGTGAAGGAAGTCTTGG + Intronic
1035388205 7:158488665-158488687 CCGGCGGGGGACTGAGGTGCAGG - Intronic
1037880145 8:22569280-22569302 CAGGCCGGAGACGGAGGGGTGGG + Intronic
1039984572 8:42436709-42436731 CTGGCCGGTGACGGAGGTGCAGG - Intronic
1040951323 8:52940932-52940954 CTGGCCAGCGAGGGAGGAGCCGG + Exonic
1047898078 8:129388919-129388941 CTGGATGGGGACTGAGGTGCGGG + Intergenic
1048244139 8:132775392-132775414 CTGGCCGGCGGCGGAGGCGGCGG + Exonic
1049572691 8:143376638-143376660 CTGGCCGGCATGGGAGGTGCGGG + Exonic
1051450216 9:17189361-17189383 CTGGCCGGGCACGGTGGTTCAGG - Intronic
1061496690 9:130978848-130978870 CTGGCAGGTGATGGAGGTTTGGG - Intergenic
1061590307 9:131593700-131593722 CTGGCAGGTGAAGGAGGCTCCGG + Intronic
1062325065 9:136009025-136009047 CTGGCTGCTGCCGGAGGTGGTGG - Exonic
1203586009 Un_KI270747v1:4109-4131 CTGAGAGGTGAGGGAGGTGCGGG - Intergenic
1186355179 X:8783317-8783339 CTGGCCGGGTACCCAGGTGCTGG - Intergenic
1189271643 X:39756115-39756137 CTTGCCGGTGACCCAGTTGCAGG + Intergenic
1195393069 X:104383364-104383386 CTGGCAGGGGAAGCAGGTGCAGG + Intergenic
1200083995 X:153593928-153593950 CTGGCCGGAGACAGAGATGGAGG - Intronic