ID: 1039984962

View in Genome Browser
Species Human (GRCh38)
Location 8:42439369-42439391
Sequence GACCAGCTGGGCCTGGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 472}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039984962_1039984975 25 Left 1039984962 8:42439369-42439391 CCCACACCCAGGCCCAGCTGGTC 0: 1
1: 0
2: 2
3: 40
4: 472
Right 1039984975 8:42439417-42439439 CCACAGAACCCAAGCTCTCCAGG 0: 1
1: 0
2: 0
3: 16
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039984962 Original CRISPR GACCAGCTGGGCCTGGGTGT GGG (reversed) Intronic
900211742 1:1459637-1459659 CACCAGCAGGTCCTGTGTGTCGG + Intronic
900224551 1:1526937-1526959 CACCAGCAGGTCCTGTGTGTCGG + Intronic
900245752 1:1635296-1635318 GCACAGCTGGGGCTGGGGGTTGG + Intronic
900256982 1:1702453-1702475 GCACAGCTGGGGCTGGGGGTTGG + Intronic
900640529 1:3686092-3686114 GGCCACCTGTCCCTGGGTGTTGG + Intronic
900962745 1:5935724-5935746 AATCAGCTGGGCATGGTTGTAGG + Intronic
901012696 1:6210359-6210381 GACCAGGTGGACCTGGGGGAGGG - Exonic
901052259 1:6431079-6431101 GAGCAGCTGGGCAGGGCTGTGGG + Intronic
901124463 1:6919271-6919293 GCCCTGCTGGGCCTGGCTGGAGG + Intronic
901136472 1:7000067-7000089 TACCAGCTGGTGCTGGGTGAGGG + Intronic
901205110 1:7490152-7490174 GACAGGCTGGTCCTGGATGTGGG - Intronic
901853434 1:12029953-12029975 GAAAAGATGGGCCTGGGCGTGGG + Intronic
902359690 1:15935657-15935679 CACCAGCTGGGGCTGGCTGCGGG - Exonic
902370635 1:16004742-16004764 GACCAGCTGGGGGTGGGTGGGGG + Intronic
902385870 1:16075441-16075463 GAGCAGCTGAGCCAGGGAGTGGG + Intergenic
903219949 1:21864044-21864066 GCTCAGCTGGGCCTGGGTGGGGG - Intronic
903604156 1:24562774-24562796 CCCCAGCTGGGGGTGGGTGTGGG - Intronic
903633078 1:24791725-24791747 AATCAGCTGGGCATGGTTGTGGG + Intronic
903846434 1:26282199-26282221 GACCAGCTGGGCCAGGGAGGGGG - Intronic
904575981 1:31505348-31505370 GATCAGCTGGGCCTGGGTGGGGG + Intergenic
904584713 1:31573775-31573797 AATTAGCTGGGCCTGGTTGTGGG + Intergenic
905634831 1:39543293-39543315 AACCAGCTGGGCATGGTGGTGGG + Intergenic
905729659 1:40288194-40288216 GGCCAGCTGGTTCTGGGTGATGG + Intronic
905923248 1:41732836-41732858 GATCAGATGGGACTGGGGGTCGG + Intronic
906251592 1:44314863-44314885 TACTAGTTGGGGCTGGGTGTAGG - Intronic
906516312 1:46440810-46440832 GCCCAGCTGGACCTGGGTGGGGG + Intergenic
907460980 1:54605304-54605326 GCCCTGCTGGGGCTGGGGGTGGG + Intronic
907767127 1:57423238-57423260 GACTAGCTGGGCGTGGGGGGAGG + Intronic
908525706 1:64985602-64985624 AACCAGCTGGGCATTGTTGTTGG - Intergenic
911053914 1:93694948-93694970 GCCCAGGTGGGCCAGAGTGTAGG - Intronic
912579411 1:110706515-110706537 AATCAACTGGGCCTGGGAGTTGG - Intergenic
913184440 1:116356170-116356192 GATCACCTGGGCCTGGGAGGTGG + Intergenic
913972173 1:143423708-143423730 GCCCAGAAGGACCTGGGTGTGGG - Intergenic
914066554 1:144249321-144249343 GCCCAGAAGGACCTGGGTGTGGG - Intergenic
914112599 1:144717033-144717055 GCCCAGAAGGACCTGGGTGTGGG + Intergenic
914806429 1:150995390-150995412 GACCAGCTGGGCCTCCAAGTAGG + Exonic
915592841 1:156880360-156880382 GGCCAACTGGGCCTGGGCTTAGG - Intronic
916793623 1:168146020-168146042 GACCAGGTGGACCTGGCTGCTGG + Intergenic
917724245 1:177814040-177814062 GTAGAGCTTGGCCTGGGTGTGGG - Intergenic
919938775 1:202272289-202272311 GGCCAGGTGGGCTTGGGGGTGGG - Intronic
920035212 1:203060930-203060952 ACCTAGCTGGTCCTGGGTGTGGG - Intronic
920835478 1:209506821-209506843 GACCAGTTGTGCCTGGCTGGAGG - Intergenic
922256557 1:223897553-223897575 GTGAAGCTGGGCCTGAGTGTTGG + Intergenic
922806597 1:228393514-228393536 GCCCATCTGTGCCTGGGTGTGGG + Intergenic
924066823 1:240232227-240232249 GATTAGCTGGGCCTGGTGGTTGG - Intronic
924337765 1:243000412-243000434 GTGAAGCTGGGCCTGAGTGTTGG + Intergenic
924664279 1:246054696-246054718 AATCAGCTGGGGCTGGGGGTGGG + Intronic
924822322 1:247505168-247505190 GCCCAGCAGGGCCTTGGGGTAGG + Intergenic
1063123915 10:3123875-3123897 CACGTGCTGGGCCTGGGTGGAGG + Intronic
1063301288 10:4851127-4851149 GACCAGCTCTGGCTGGGTTTGGG + Intergenic
1067030552 10:42876694-42876716 TGCCAGCTGGGCCTGGGTTCAGG + Intergenic
1067731798 10:48817989-48818011 GACCTGCTGGGCCTAGCTGGAGG - Intronic
1069217002 10:65833428-65833450 AAACAGCTGGGCATGGGGGTGGG - Intergenic
1070356886 10:75648527-75648549 GACCACGTGGGCCTGGGTCCTGG + Intronic
1070788963 10:79178497-79178519 GCCCAGCTGGGCGGGGGTGAAGG + Intronic
1071661270 10:87505145-87505167 GACCAGCTGCACCGGGGTGCAGG - Exonic
1072010148 10:91295865-91295887 GACCAGATGGTTCTGGGTTTGGG + Intergenic
1073201200 10:101737340-101737362 AATTAGCTGGGCCTGGTTGTGGG - Intergenic
1073202815 10:101749965-101749987 GAGCAGCAGGGCCTGGGAGTTGG - Intergenic
1073674599 10:105631476-105631498 TATCAGCTGGGCATGGTTGTGGG - Intergenic
1074507311 10:114082943-114082965 GTTCAGCTGAGCCTGGGTGGAGG + Intergenic
1075047864 10:119160090-119160112 GATCAGCTGAGCCTGGGAGTTGG + Intronic
1076226212 10:128778406-128778428 GACCAGCTTGGCCAACGTGTTGG + Intergenic
1076347376 10:129788647-129788669 TACCTGCAGGGCCTGGGTTTTGG + Intergenic
1076581931 10:131517595-131517617 GCCCAGCTGGGCCTGGGGCCTGG + Intergenic
1077081250 11:725680-725702 GCCCCGCAGAGCCTGGGTGTGGG + Intronic
1077300049 11:1842577-1842599 GGCCAGATGGGGCTGGGTCTTGG - Intergenic
1077307690 11:1875325-1875347 GCCCAGAAGGACCTGGGTGTGGG + Intronic
1077326270 11:1965391-1965413 GGGCAGCTGGGCCTGGCCGTGGG + Intronic
1077351549 11:2095371-2095393 GACCAGTCGGGCCTGGGCGAGGG - Intergenic
1077508449 11:2942921-2942943 GCCCAGCCTGGCCTGGGTGAAGG - Intergenic
1079027596 11:16961204-16961226 AACCAGCTGGGACTGGGGATGGG - Intronic
1079098507 11:17526579-17526601 CACCAGCTGGGCCTGGCCGAGGG + Intronic
1079562321 11:21837614-21837636 GACCAACTGGGCATAGGTGCCGG + Intergenic
1081803640 11:45877205-45877227 GTACAGCTGGGCCTGGATGGGGG - Intronic
1081974950 11:47227648-47227670 GGCCAGCTGGGCGTGGTGGTGGG - Intronic
1083174723 11:60942375-60942397 GACCAGCTGTGCCTGGGCTCTGG - Intronic
1083274085 11:61587240-61587262 TACCAGCTGGGCTCGGGTCTGGG - Intergenic
1083626381 11:64074051-64074073 GGCCAGCTGGGGATGGGGGTGGG + Intronic
1083702042 11:64485991-64486013 GATTAGCTGGGCCTGGTGGTGGG - Intergenic
1083704059 11:64500966-64500988 GGCCGGCTGGGCCTGCTTGTGGG + Intergenic
1084004971 11:66317813-66317835 TTCCAGCTGGGCCAGCGTGTGGG + Intergenic
1084429065 11:69101385-69101407 TCCCAGCTGGGCCTGGGTACCGG + Intergenic
1084537548 11:69766240-69766262 AATCAGCTGGGCCTGGTGGTGGG + Intergenic
1084777164 11:71384922-71384944 GATTAGCTGGGCGTGGTTGTGGG + Intergenic
1084778900 11:71396145-71396167 GGCCTGCTGGGGCTGGGTGCGGG + Intergenic
1085038974 11:73315844-73315866 GACCAGCTGGGTTTGGGAGGCGG + Intronic
1085532185 11:77198438-77198460 GAAGGGCTGGGCCTGGGTGTGGG + Intronic
1085740867 11:79077295-79077317 ACCCACCTTGGCCTGGGTGTGGG - Intronic
1085821047 11:79794219-79794241 GATCAGCTAAGGCTGGGTGTTGG + Intergenic
1086010633 11:82098928-82098950 GACAACCTGGCCTTGGGTGTTGG - Intergenic
1088216173 11:107512398-107512420 GATCACCTGGGCCTGGGAGGTGG - Intronic
1088678860 11:112222157-112222179 GACCTGAAGGGGCTGGGTGTGGG - Intronic
1089746029 11:120617583-120617605 GATCAGTGGGGCCTGGTTGTAGG + Intronic
1090360010 11:126165621-126165643 GAACGGATGGGCCTGGGTGTTGG + Intergenic
1091107977 11:132941142-132941164 GAGCAGCTGGGCTTGGGAATGGG - Intronic
1202809251 11_KI270721v1_random:20570-20592 GGGCAGCTGGGCCTGGCCGTGGG + Intergenic
1091633548 12:2180363-2180385 GCCCAGCAGGGCCTGAGTGCTGG + Intronic
1091869209 12:3873272-3873294 TAGCCGCGGGGCCTGGGTGTTGG + Exonic
1092238120 12:6822222-6822244 CACCAGCTGGGCCTGGGTGGAGG + Intronic
1092342768 12:7690578-7690600 GCCCAGCTGGGCCTGGACTTGGG - Exonic
1092372803 12:7931261-7931283 AACCAGCTGGGCATCGTTGTTGG - Exonic
1092787625 12:12042157-12042179 AATCAGCTGGGCTTGGTTGTGGG + Intergenic
1093997011 12:25653895-25653917 GACCAGCCAGGCCGGGGTGGGGG + Intergenic
1094020601 12:25909861-25909883 GACTAGGTTGGGCTGGGTGTGGG - Intergenic
1094619288 12:32064788-32064810 GATCACCTGAGCCTGGGTGGTGG + Intergenic
1095119605 12:38401285-38401307 GACCAGCCGGGCGTGGTGGTTGG - Intergenic
1095610217 12:44119655-44119677 GACTACCTGGGGCTGTGTGTAGG + Intronic
1095943469 12:47740668-47740690 GAGCAGCTGGGCCCGGGGGCCGG + Exonic
1096158920 12:49360396-49360418 GACCAGTTGAGCCTGGGAGCTGG + Intergenic
1096331826 12:50720077-50720099 AATCAGCTGGGCCTGGTGGTGGG - Intronic
1096477848 12:51919281-51919303 GACCAGATGGCCCTGGGGGCAGG - Intronic
1101794382 12:107959281-107959303 GAGCAGCTGGGCCTGGTTCTGGG + Intergenic
1101870350 12:108560826-108560848 GAGCAGGTGGGCCCGGGGGTGGG - Exonic
1102074997 12:110052771-110052793 GAACAGCTGGGGCTGAGTCTTGG - Intronic
1102222644 12:111204922-111204944 TATCAGCTGGGCCAGGGTGATGG - Intronic
1102240643 12:111322535-111322557 GACCAGCTCGGCCAGGCAGTGGG + Exonic
1102985333 12:117273103-117273125 GACCAGCTGGGCCTCAGGGAAGG - Intronic
1103467464 12:121153224-121153246 GAACAGCTGGGACTGAGTCTTGG + Intronic
1103715152 12:122940804-122940826 CACCTGCAGGACCTGGGTGTGGG + Exonic
1103901071 12:124303839-124303861 GACCGGCTGGGGGTGGGGGTGGG + Intronic
1103968577 12:124655519-124655541 GGCCAGCTGGGGCTGGGTTGTGG + Intergenic
1104048984 12:125184059-125184081 GACCAGGTAGTCCTGAGTGTGGG + Intergenic
1104373255 12:128242970-128242992 GTCCACCTGGGCCTGGCTATGGG - Intergenic
1104606400 12:130192765-130192787 ATGCAGCTGGGCCTGGGTGGGGG + Intergenic
1104722039 12:131049817-131049839 GACCAGCTGTGCCTGTGAGTGGG + Intronic
1104794518 12:131507961-131507983 GACGATGTGGACCTGGGTGTCGG - Intergenic
1104928543 12:132326496-132326518 GACCAGCGGAGGCAGGGTGTGGG + Intronic
1104959875 12:132483600-132483622 GACCTGCTGGGCATGGGAGGTGG + Intergenic
1112905276 13:104410705-104410727 GACCAGCTGGGCTTGGATTCTGG + Intergenic
1113137150 13:107104224-107104246 GATAAACTGGGCCTGGGAGTGGG - Intergenic
1113780317 13:112972987-112973009 GAACAGCTGTGCCTGTGTGGTGG - Intronic
1114483988 14:23052407-23052429 GAGGAGCTGTCCCTGGGTGTGGG - Intronic
1115355699 14:32444243-32444265 GAGTAGCTGGGCTTGGGTGGTGG + Intronic
1117119725 14:52553662-52553684 GACCAGCGGGGGCGGGGGGTGGG + Intronic
1117547585 14:56805727-56805749 GAGCAGCTGGGGGTGGGGGTGGG - Intronic
1119472268 14:74907474-74907496 GGGCAGCTGGAGCTGGGTGTGGG + Exonic
1119768394 14:77205229-77205251 GGCCAGCAAGGCCTGGGTGTGGG - Intronic
1121169552 14:91842043-91842065 GACCAGCTGAGCCTGGGAGGTGG - Intronic
1121320747 14:92990337-92990359 GCCCATCTGGTCCTGGGTGATGG - Intronic
1121775961 14:96591034-96591056 GCCCTGCAGGCCCTGGGTGTGGG + Intergenic
1122270476 14:100566685-100566707 GACAAGGTGGGCCTGGCTGATGG + Intronic
1122297549 14:100713854-100713876 GAGCAGCTGTCCCTGGGGGTGGG + Intergenic
1122400879 14:101466642-101466664 GACCACCTTGGCCTGGCTGGGGG - Intergenic
1122402691 14:101476612-101476634 GAGCACCTGGGCATAGGTGTGGG + Intergenic
1122553151 14:102560969-102560991 GCCCTGGTGGGCCTGGGTCTGGG - Intergenic
1122640339 14:103155859-103155881 GAGCAGCTTGTCCTGGGTTTGGG + Intergenic
1122816920 14:104318578-104318600 CCCCAGCTGAGGCTGGGTGTGGG - Intergenic
1122900843 14:104781733-104781755 ACCCAGCAGGGCCTGAGTGTGGG + Intronic
1122917259 14:104865024-104865046 GGCCAGCGGGGCCTGGGCGGTGG + Intergenic
1123045762 14:105513155-105513177 GACCAGCTGACCCTGGGTGCTGG - Intergenic
1123130435 14:105981389-105981411 GCTCAGCTGGGTCTGGGTGCTGG + Intergenic
1123131195 14:105986863-105986885 CACCAGCTGCACCTGGGAGTGGG + Intergenic
1123133244 14:106005376-106005398 CACAAGCTGGACCTGGGAGTGGG + Intergenic
1123135639 14:106025426-106025448 CACCAGCTGCACCTGGGAGTGGG + Intergenic
1123145138 14:106122553-106122575 CACCAGCTGCACCTGGGAGTGGG + Intergenic
1123151388 14:106185180-106185202 CACCAGCTGAACCTGGGAGTGGG + Intergenic
1123160851 14:106276827-106276849 TACCAGCTGGACCTGGGCGTGGG + Intergenic
1123208572 14:106737391-106737413 TACCAGCTGGACCTCGGCGTGGG + Intergenic
1123223110 14:106874862-106874884 CACCAGCTGCACCTGGGAGTAGG + Intergenic
1123399788 15:19973063-19973085 CACCAGCTGCACCTGGGAGTGGG + Intergenic
1123410017 15:20050410-20050432 GCTCAGCTGGGTCTGGGTGCTGG - Intergenic
1123435530 15:20251437-20251459 GGCCAGCTTGGCCTGCGTGAAGG - Intergenic
1123519349 15:21057117-21057139 GCTCAGCTGGGTCTGGGTGCTGG - Intergenic
1123580672 15:21712610-21712632 GCTCAGCTGGGTCTGGGTGCTGG + Intergenic
1123581427 15:21718089-21718111 CACCAGCTGCACCTGGGAGTGGG + Intergenic
1123583266 15:21735789-21735811 CACCAGTTGGACCTGGGAGTGGG + Intergenic
1123617321 15:22155233-22155255 GCTCAGCTGGGTCTGGGTGCTGG + Intergenic
1123618076 15:22160712-22160734 CACCAGCTGCACCTGGGAGTGGG + Intergenic
1123619916 15:22178386-22178408 CACCAGTTGGACCTGGGAGTGGG + Intergenic
1123701054 15:22915052-22915074 GACCAGCTGGGCATAGCTGCAGG + Intronic
1125600184 15:40911335-40911357 GTCTGGCTGGCCCTGGGTGTGGG - Intergenic
1125655050 15:41349376-41349398 GAGCAGCTGGACTTGGGTCTGGG - Intronic
1125844902 15:42843199-42843221 AGCCAGCTTGGCCTGTGTGTAGG - Intronic
1128594033 15:68928903-68928925 CTCCACCTGCGCCTGGGTGTGGG - Intronic
1128611406 15:69076523-69076545 GCCCATCTGTCCCTGGGTGTAGG + Intergenic
1128701444 15:69807397-69807419 GCCCAGCTGGTCCTTGGTGGCGG - Intergenic
1128943444 15:71806665-71806687 GCCCAGCAGGGCCTGGGGGTTGG - Intronic
1129253181 15:74319738-74319760 GACCGGCTGGGCTGGGGTGGGGG - Intronic
1129602471 15:77008283-77008305 CAGCAGCTGAGCCTGGGTCTAGG + Intronic
1129766519 15:78172947-78172969 CACTAGCAGGGCCTTGGTGTTGG + Intronic
1129877589 15:78986229-78986251 GAGCAGCTGGGGATGGGGGTGGG + Intronic
1131272276 15:90954741-90954763 GGCCAGCTGAGCCTGGTTGAAGG + Intergenic
1132403557 15:101528670-101528692 CTGCAGCTGGGCCTGGGTGGTGG + Intergenic
1132404143 15:101532249-101532271 AATTAGCTGGGCCTGGGGGTGGG - Intergenic
1202989542 15_KI270727v1_random:446855-446877 GCTCAGCTGGGTCTGGGTGCTGG + Intergenic
1132617338 16:848135-848157 CGCCAGGTGGGCCCGGGTGTGGG + Intergenic
1132630192 16:913549-913571 GCCCAGCTGTGCCTGGGTGCTGG - Intronic
1133008301 16:2896697-2896719 GGCCCGCTGGGCCTCGGGGTGGG - Exonic
1133015390 16:2937262-2937284 GACCCGCCGGCCCTGGGTGATGG - Exonic
1134117135 16:11557534-11557556 GATCACCTGAGCCTGGGTGGTGG - Intronic
1134439026 16:14286435-14286457 CACCAGCTGACTCTGGGTGTGGG - Intergenic
1134626432 16:15725961-15725983 GCCCAGCTGGGGTTGGGGGTAGG - Exonic
1136849076 16:33599558-33599580 GGCCAGCTTGGCCTGCGTGAAGG + Intergenic
1137546774 16:49410293-49410315 GGCCAGCTGGTGCTGGCTGTTGG + Intergenic
1137668411 16:50265507-50265529 GACCAGCTGGGGCTGGACGCTGG + Intronic
1137789579 16:51163820-51163842 CACCAGCTGGGCGGGGGTGGTGG + Intergenic
1137942342 16:52700576-52700598 GACCAGCTGGACCTGAGTAGTGG - Intergenic
1138607327 16:58097453-58097475 GCCCAGCTGGGCCTGGCCCTTGG + Intergenic
1139511824 16:67432121-67432143 GACCAGGAGGGCTTGGGGGTGGG - Intronic
1139537226 16:67584171-67584193 GACTAGCTGGGCATGGTGGTGGG + Intronic
1140674820 16:77317529-77317551 GACCAGCTGGGCCAACGTGGCGG - Intronic
1141043522 16:80693105-80693127 GATCAGTGGGGGCTGGGTGTGGG + Intronic
1141828347 16:86496194-86496216 GGCCAGTTCAGCCTGGGTGTGGG - Intergenic
1141912885 16:87071995-87072017 CACCACCTGGTCCTGGGTCTGGG + Intergenic
1142025687 16:87812253-87812275 GCCCAGCCGGGCCTGTGTGGAGG - Intergenic
1203110783 16_KI270728v1_random:1448208-1448230 GGCCAGCTTGGCCTGCGTGAAGG + Intergenic
1142569389 17:863099-863121 GCCCAGCAGAGCCTGAGTGTAGG + Intronic
1142848678 17:2694094-2694116 GGCCAGGTGGGGCTGGGTGGAGG - Intronic
1142888592 17:2928752-2928774 GACCATCTGGGTCTTGGTGCAGG - Intronic
1142980500 17:3668500-3668522 GACCGGCTGGCCCGGGATGTAGG + Exonic
1143165034 17:4893382-4893404 GAGAAGCTGGGCCTGGGTGGAGG - Intronic
1143314800 17:6024114-6024136 AATTAGCTGGGCCTGGTTGTGGG + Intronic
1144628371 17:16857081-16857103 AACCAGCTGGCTCTGGGTCTGGG + Intergenic
1145016559 17:19402620-19402642 GCCAACCTGGGCCTGGGTGATGG + Intergenic
1145159963 17:20567651-20567673 AACCAGCTGGCTCTGGGTCTGGG + Intergenic
1146231580 17:31115618-31115640 GACCAGCTGCTTCTGGGTGATGG + Intronic
1146370978 17:32265704-32265726 GACCGACTGGGCCCGGGTGGCGG + Intergenic
1146660087 17:34659800-34659822 GCCCAGCTGAGCCTGGCTGCTGG - Intergenic
1146762999 17:35494990-35495012 GATCATCTGAGCCTGGGTGGTGG - Intronic
1146793472 17:35765802-35765824 GAGCAGGTGGGCATGGGTGCAGG - Intronic
1147613558 17:41815169-41815191 AGCCAGCTGGACCTGGGGGTAGG + Intronic
1148090827 17:45021718-45021740 GGCCAGTCGGGCCTGGGGGTGGG + Intergenic
1148187450 17:45654924-45654946 GTCAACCTGGGTCTGGGTGTGGG + Intergenic
1148444194 17:47727721-47727743 GACCACCTGGTGCTGGGTGCTGG + Intergenic
1148478300 17:47943425-47943447 CACCAGGTGGGCATGGCTGTGGG + Exonic
1148490821 17:48023377-48023399 GGCCAGCCAGGCCTGGGTGTGGG - Intergenic
1148604152 17:48916192-48916214 GGCCAGATGGGCCTGGCTCTGGG + Intronic
1148907756 17:50922041-50922063 GATTAGCTGGGCCTGGTGGTGGG - Intergenic
1149422928 17:56528300-56528322 GTGCAGCTGGGACTGGGGGTGGG + Intergenic
1149516817 17:57287316-57287338 GCCCTGCTGGGCCTGAGTTTGGG + Intronic
1149581492 17:57753530-57753552 TACCACCTGGGTCTGGGTGAAGG - Intergenic
1150520787 17:65865524-65865546 GCCCAGCTGTGCAAGGGTGTGGG - Intronic
1151105482 17:71611621-71611643 GAACAGCTGGGGTTGGGGGTGGG - Intergenic
1151415045 17:73956724-73956746 GCTCAGCTGGGCCTGGGGGGAGG - Intergenic
1151693033 17:75698834-75698856 GACCAGCTGGGCGTGGGGATGGG - Intronic
1151882653 17:76904417-76904439 GTCCAGGTGGGCCTGGGAGGTGG + Exonic
1151903690 17:77034315-77034337 GACCAGGTGGGCTGGGGGGTGGG + Intergenic
1152017190 17:77758376-77758398 AATCAGCTGGGCGTGGTTGTGGG - Intergenic
1152228768 17:79104468-79104490 TGCCAGCTGGGCATGGGGGTAGG + Intronic
1152351950 17:79789246-79789268 GAGAAGCTGGGCCTAGATGTTGG + Intergenic
1152394438 17:80023789-80023811 CGCCAGCTGGGCCTGGGAGGTGG - Intronic
1152401793 17:80070899-80070921 GTCCATCTGGGCCTGCCTGTGGG + Intronic
1152403140 17:80081770-80081792 CACCAGCTGGTCCTGGCTGAGGG - Exonic
1152891219 17:82882687-82882709 GAACAAGTGGGCCTGGGTCTGGG + Intronic
1153741734 18:8137331-8137353 GGCCAGCTGGGGCTGTGTGTTGG - Intronic
1155054762 18:22172963-22172985 CATCAGCTGGGCCTTGGTCTGGG + Intronic
1155154552 18:23147805-23147827 GTCTTCCTGGGCCTGGGTGTGGG - Intronic
1157525221 18:48375344-48375366 GTCCAGCTTGGCCTGGGAATTGG - Intronic
1157728919 18:49987175-49987197 GCCCAGCTGGGCCTGAGTTGGGG - Intronic
1157842069 18:50968050-50968072 GGACAGCTGGGCCAGGGTGCGGG + Exonic
1159808942 18:72992986-72993008 CACTAGCTGGGCCTGGTGGTGGG + Intergenic
1159969129 18:74627550-74627572 GACCACTTGAGCCTGGGAGTTGG - Intronic
1160425394 18:78775414-78775436 AATCAGCTGGGCGTGGTTGTGGG + Intergenic
1160548537 18:79678898-79678920 GATCACCTGAGCCTGGGAGTTGG - Intergenic
1160704758 19:524727-524749 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1160704779 19:524782-524804 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1160704821 19:524894-524916 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1160832664 19:1110988-1111010 GCGCCTCTGGGCCTGGGTGTGGG + Intronic
1160907255 19:1457182-1457204 GACCTGCTGGGACTGGCTGCAGG + Exonic
1161732994 19:5973605-5973627 GACCAGCAGGGCCTGGGCTCTGG - Intronic
1162285100 19:9732607-9732629 GATTAGCTGGGCATGGTTGTGGG - Intergenic
1162329218 19:10017129-10017151 GTCCAGCTGGGCCACGGTGAGGG - Exonic
1162925948 19:13930594-13930616 GCCCAGCCAGGCCTGGGTGAGGG - Exonic
1163098895 19:15081611-15081633 GACTAGCTGGGCATGGTGGTGGG + Intergenic
1163259839 19:16182386-16182408 GATCACTTGAGCCTGGGTGTAGG - Intergenic
1163474533 19:17517318-17517340 GACCTGCTGATCCTGGGGGTGGG + Exonic
1164840692 19:31390189-31390211 GCCCAGCAGGGCCTGGGGCTGGG + Intergenic
1165229456 19:34377826-34377848 GTTCAGCTGGGCCAGGGTTTTGG - Exonic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1165494777 19:36146069-36146091 GACATGCTGGGGCTGGGAGTGGG + Intronic
1165743525 19:38217382-38217404 GCCCAGCTGGGGGTGGGGGTGGG - Intronic
1165831745 19:38733974-38733996 GACAAGCTGAGGCTGGGTGGGGG + Intronic
1166099889 19:40565656-40565678 GTCCAGCTGTGCCTGGATCTGGG - Exonic
1166144829 19:40826575-40826597 GTCCAGCAGGGGCAGGGTGTGGG - Intronic
1166182913 19:41121632-41121654 GTCCAGCAGGGGCAGGGTGTGGG + Intronic
1166324616 19:42041675-42041697 AACCAGCGGGGCCTGAGCGTGGG - Intronic
1166748485 19:45153370-45153392 GCGGCGCTGGGCCTGGGTGTGGG - Exonic
1166917327 19:46204302-46204324 GACGAGCTGGGCCTGGGACTGGG + Intergenic
1167497569 19:49828558-49828580 GACCGGCCCGGCCTGGGTGGAGG - Intronic
1167591323 19:50406027-50406049 GACGGTCTGGGGCTGGGTGTGGG - Intronic
1167620635 19:50558315-50558337 GATCACCTGGGCCTGGGAGGTGG - Intronic
1168119473 19:54243540-54243562 GACCACCTGGGCCCGGGAGGCGG + Intronic
925344327 2:3159890-3159912 GACTGGCTGGGCCTGGGGCTGGG + Intergenic
925427537 2:3762948-3762970 GGCAGGCTGGGCCTGGGTGAAGG + Intronic
926302980 2:11617667-11617689 GACGTGCAGGGCCTGGGTGCGGG + Intronic
927009353 2:18886670-18886692 AATCAGCTGGGCATGGTTGTAGG - Intergenic
927040993 2:19230146-19230168 GGTCAGCTAGGCCTGGGTTTGGG + Intergenic
927511275 2:23645296-23645318 GACCAGGTGGGCTTGGATCTGGG + Intronic
928064427 2:28148956-28148978 GACCAGCTCAAACTGGGTGTGGG + Intronic
928076258 2:28267383-28267405 CAACAGCTGGGCCTGGGGGTGGG - Intronic
928767570 2:34665680-34665702 GACCAACTGGCCCTGGGCCTAGG + Intergenic
928921072 2:36528654-36528676 GACAACCTGGGCCTCCGTGTAGG - Intronic
930125602 2:47793877-47793899 AATCAGCTGGGCCTGGTGGTGGG - Intronic
930662699 2:54070821-54070843 GATCACTTGAGCCTGGGTGTTGG - Intronic
930719762 2:54627788-54627810 GGCCAGCGGGGCCAGGGTGGGGG - Intronic
930721764 2:54645140-54645162 GAACTGCTGGGCCTGGGACTTGG - Intronic
931231086 2:60375425-60375447 GTGCAGCTGGTCCTGAGTGTTGG - Intergenic
931707275 2:64957704-64957726 GCCCAGCTGGGCCTGGGACTGGG - Intergenic
931924530 2:67057020-67057042 GATCAGCTGGGCATGGTGGTGGG - Intergenic
932791030 2:74654564-74654586 GAGCAGGTGGGTGTGGGTGTGGG - Intronic
933123401 2:78571600-78571622 AACTAGCTGGGCGTGGGTGCGGG + Intergenic
933184155 2:79260128-79260150 GGCCAGCTTGCCATGGGTGTTGG + Intronic
934070032 2:88375290-88375312 TGCCAGCTGGGCCTGTCTGTAGG + Intergenic
934176870 2:89584645-89584667 GCCCAGAAGGACCTGGGTGTGGG - Intergenic
934287177 2:91659005-91659027 GCCCAGAAGGACCTGGGTGTGGG - Intergenic
934907358 2:98216988-98217010 GACCACCTGAGACTGGGTGCGGG - Intronic
936911915 2:117602284-117602306 GGGCATCTGGGCATGGGTGTTGG - Intergenic
940290375 2:152072787-152072809 AATCAGCTGGGCCTGGTGGTGGG - Intronic
941804159 2:169693968-169693990 GGTCAGCTGGGGCTGGGGGTGGG + Intronic
942841979 2:180372916-180372938 AACTAGCTGGGCCTGGTGGTGGG + Intergenic
946161769 2:217839978-217840000 GTTCAGCTGGGCCTGGGTAGGGG - Intronic
946405918 2:219492046-219492068 GTCCTTCTGGGTCTGGGTGTTGG + Intronic
946939955 2:224760173-224760195 ACCAAGGTGGGCCTGGGTGTAGG + Intergenic
947455591 2:230250868-230250890 GGCCAGGAGGGCCTGGGTGATGG + Intronic
947456105 2:230255316-230255338 GACCAGGAGGACCTGGGTGGGGG + Intronic
947731081 2:232432142-232432164 GAGAAGGTGGGCTTGGGTGTTGG + Intergenic
947916800 2:233837893-233837915 CGCTAGCTGGGCCAGGGTGTGGG - Intronic
948485693 2:238279480-238279502 ACACAGCTGAGCCTGGGTGTAGG - Intronic
948588445 2:239035486-239035508 CCCCAGCGGGGCCTGGGTGTGGG + Intergenic
948761843 2:240197204-240197226 GACCAGCTGGGACTGAGGATGGG + Intergenic
948891587 2:240909400-240909422 GGCCAGCTCTGCCTGGGTGTTGG + Intergenic
1168852432 20:985807-985829 GCCCACCTGGGCTTGGGAGTTGG - Intronic
1169201300 20:3711469-3711491 GGACAGCTAGGCCCGGGTGTAGG + Intergenic
1169687463 20:8291305-8291327 CAGCAGCTGGGCCTGGGAGGTGG - Intronic
1170896565 20:20420222-20420244 GACAAGCTGGGCCTGGGCACAGG + Intronic
1171035064 20:21707456-21707478 GAGCCACTGGGCCTGGGAGTGGG - Intronic
1172510545 20:35497939-35497961 GGCCAGCTGGGCCTGGGCCTGGG - Exonic
1172603536 20:36199771-36199793 GCCAAGCTTGGCCTGGCTGTGGG + Intronic
1172694532 20:36812997-36813019 CCCCAGCTGGGGCTGGGTCTGGG - Intronic
1172938419 20:38637768-38637790 GACCAGCGGGACCTGTGTGCTGG - Exonic
1174182064 20:48681196-48681218 GCCCAGCTGGGCCAAGGGGTGGG - Intronic
1174516385 20:51095578-51095600 GGCCAGGTGGGCCTGGATGCTGG - Intergenic
1174539043 20:51275046-51275068 GACCAGCAGGGCTTGTGGGTGGG + Intergenic
1174545791 20:51324184-51324206 GCCCAGCTTGGCTTGGGTGCGGG + Intergenic
1175124671 20:56742393-56742415 GGAGAGCTGGGGCTGGGTGTGGG + Intergenic
1175172964 20:57092798-57092820 CTCCAGCTGGGCCTGCGTGGAGG - Intergenic
1175414115 20:58790287-58790309 GTCCCTCTGGGCCTGGGTGTTGG + Intergenic
1176022966 20:62971404-62971426 GGCCAGCTGGGGCTGTGTGTGGG + Intergenic
1176146071 20:63566092-63566114 CACCAGCTGGGACTGGGCGCGGG + Exonic
1176170100 20:63692893-63692915 GTCCTGCAGGGCCTGGGTGAAGG - Exonic
1176230477 20:64030193-64030215 AAGGAGCTGGGCCTGAGTGTGGG + Intronic
1176295604 21:5070503-5070525 GACAAGGTGGGGCTGGGTGGGGG - Intergenic
1177377777 21:20295916-20295938 GATCAGCTGGGCGTGGTTGTGGG + Intergenic
1178312938 21:31544670-31544692 GAGCAGCTGGGCATGGTTATGGG + Intronic
1179476363 21:41648732-41648754 GACCAGCTGGGCCCCGGGGGAGG + Intergenic
1179861445 21:44191621-44191643 GACAAGGTGGGGCTGGGTGGGGG + Intergenic
1180167635 21:46038213-46038235 GCCCAGAAGGGCCTGGGGGTTGG + Intergenic
1182322535 22:29487543-29487565 GATCACCTGAGCCTGGGAGTTGG + Intronic
1182423011 22:30257628-30257650 GAGAAGCAGGGCCGGGGTGTGGG + Intergenic
1182522197 22:30891008-30891030 GAACAGCTTGGCCAGAGTGTGGG - Intronic
1182765228 22:32753502-32753524 GCCCAGCGGTGGCTGGGTGTAGG - Intronic
1183674995 22:39294224-39294246 GACCAGCTGGGCCCAGGACTGGG + Intergenic
1183984113 22:41560202-41560224 CTCCAGCTGGCCCTGGGTTTAGG + Intergenic
1184111702 22:42399296-42399318 AACTAGCTGGGCATGGTTGTGGG + Intronic
1184157895 22:42680616-42680638 GACCAGCTGTTTCTGGGTGGAGG - Intergenic
1184246081 22:43236431-43236453 CAGCAGCTGTGCCTGGCTGTTGG + Intronic
1184497668 22:44851750-44851772 GATCACCTGAGCCTGGGAGTTGG + Intronic
1184817519 22:46883665-46883687 GATCAGCTAGGCCGTGGTGTAGG - Intronic
949355802 3:3179538-3179560 GTGCAGCTGGGCCTGGGAGGCGG - Intronic
949462239 3:4305232-4305254 AATCAGCTGGGCGTGGTTGTAGG - Intronic
950024127 3:9809280-9809302 GACCTGCTGGGCCTGGCAGATGG - Intronic
952269493 3:31817557-31817579 GCCCTGCTGGGTGTGGGTGTGGG - Intronic
953032866 3:39189419-39189441 GGCCACCTGTGTCTGGGTGTCGG + Exonic
953957494 3:47243161-47243183 GACCAGCTGGGTCTTGGAGGTGG + Exonic
954106748 3:48413718-48413740 GCCCAGGTGGGCTTGGGGGTGGG - Exonic
954297176 3:49680742-49680764 GCCAAGCTGGGCCTGTGTCTTGG - Intronic
954415493 3:50391343-50391365 GAGGAGCTGGGCCAGGGCGTGGG - Intronic
954432491 3:50478283-50478305 GTCCACCAGGGCCTGGTTGTGGG + Intronic
954811281 3:53249853-53249875 GACCAGTTTGCCCTGGGTGCTGG - Intronic
956389443 3:68755711-68755733 TACCACCTGGGCCTGGCTGTAGG - Intronic
961798965 3:129429881-129429903 GCCCAGCTGGGCCTGGAGGGTGG - Intergenic
962264027 3:133933158-133933180 GAACAGCTGGGCATGGGTCATGG - Exonic
962321905 3:134397238-134397260 AATCAGCTGGGCATGGTTGTGGG + Intergenic
962933630 3:140059720-140059742 GACCATCAGTGCCTGGGAGTAGG - Intronic
965392596 3:168123007-168123029 GAGCAGCTGTGCCTGGGTTCTGG - Intergenic
965520177 3:169662900-169662922 AACCAGCTAGTCCCGGGTGTGGG - Intronic
966516617 3:180828169-180828191 AACCCGCTGGCCCTGGGTGATGG + Intronic
966723236 3:183085540-183085562 GATCACTTGAGCCTGGGTGTTGG + Intronic
967859746 3:194141722-194141744 GCCCCGCCGGGCCTGGGGGTGGG + Intergenic
968442245 4:629843-629865 GAGCAGCTGGGCCTCGCTCTGGG - Intronic
968470849 4:781658-781680 GACCGGCAGGGCCTGGGGGCAGG + Intergenic
968517658 4:1021664-1021686 GCCCAGCCGGGCCTGGGCATGGG - Intronic
968870309 4:3238745-3238767 CACCTGCTGCGCCTGGGTGGCGG - Intronic
969244621 4:5924455-5924477 CTCCTGCTGGCCCTGGGTGTGGG - Intronic
969470660 4:7385633-7385655 GCAAAGCTGGGCCTGGGTGAGGG + Intronic
969639560 4:8388762-8388784 AGCCAGCAGGGCCTGGGAGTGGG + Intronic
969712596 4:8852543-8852565 CACACGCGGGGCCTGGGTGTGGG + Intronic
971266393 4:25099677-25099699 GGCCAGCTGGCCCTGGGCCTGGG + Intergenic
977201773 4:94124635-94124657 GATCAGCTGGGCGTGGTGGTGGG - Intergenic
977742154 4:100498628-100498650 GGCCAGCTGGGCATGGTGGTGGG - Intronic
978382069 4:108139560-108139582 GGCCAGCAGGGCCAGGGTGGAGG - Intronic
978502660 4:109425611-109425633 GAACAGCTAGGCCTTGGTGATGG + Intergenic
978761452 4:112358828-112358850 GTCCTGCAGGGCCTGGGTGAAGG - Intronic
980180114 4:129392302-129392324 CTGCAGCTGTGCCTGGGTGTTGG - Intergenic
981996262 4:150978158-150978180 AACCACCTGGAGCTGGGTGTAGG - Intronic
985035686 4:185838177-185838199 GGCCAGCCAGGCCTGGGTGCAGG - Intronic
985490148 5:174324-174346 GGCCAGCAGGGCCGGGGTGGGGG + Intronic
985533566 5:448325-448347 TGCCAGCTGGCCCTGGGTGGTGG + Intronic
985567447 5:626732-626754 GACCCCCTGAGCCTGGGAGTTGG + Intronic
986172576 5:5326324-5326346 TTCCAGCTGGGCGTGGGGGTGGG - Intergenic
987860761 5:23485081-23485103 GATCACCTGAGCCTGGGAGTTGG + Intergenic
988722476 5:33892242-33892264 GGCCAGCTGGGCCTGGCGTTCGG - Intergenic
989139537 5:38189245-38189267 GACCTCCGGGGCCTGGGTGTTGG + Intergenic
989146724 5:38257761-38257783 GCCCAGCTGGGCCTGGGGCAGGG - Intergenic
991699760 5:69306413-69306435 GATCACTTGGGCCTGGGAGTTGG - Intronic
992146534 5:73855581-73855603 AATCAGCTGGGCCTGGTGGTGGG + Intronic
992499826 5:77331000-77331022 GACCAGCTCGGTTTTGGTGTGGG + Intronic
993907708 5:93642065-93642087 GATCACTTGGGCCTGGGTGATGG - Intronic
994617699 5:102127216-102127238 AACCAGCTATGTCTGGGTGTTGG - Intergenic
998007381 5:138666000-138666022 CCACTGCTGGGCCTGGGTGTTGG - Intronic
998231631 5:140364606-140364628 CACCTCCTGGGCCTGGGTATTGG - Exonic
998388332 5:141771270-141771292 GAGGAGCTGGGGCTGGGGGTGGG + Intergenic
998511764 5:142719779-142719801 GACCACCTGGGCTTCGGTCTTGG - Intergenic
998828961 5:146137043-146137065 AATTAGCTGGGCCTGGTTGTGGG - Intronic
999294012 5:150446744-150446766 AACCTGCTGGGCTTGGGTGCTGG - Intronic
999685695 5:154100955-154100977 AACCAGCTGGTCCCAGGTGTTGG - Intronic
999906220 5:156143607-156143629 GACCAGCATGCCCTGGATGTGGG + Intronic
999981045 5:156958121-156958143 AATCAGCTGGGCGTGGTTGTGGG + Intronic
1001293972 5:170485796-170485818 GCCCAGCTGGGGCTGGGGCTGGG - Intronic
1001435788 5:171698326-171698348 GACCAGTTAGTCCTGAGTGTGGG + Intergenic
1001524124 5:172416474-172416496 AACTAGCTGGGCGTGGTTGTGGG - Intronic
1001722261 5:173866597-173866619 GTACAGCTGGGCCTGGCTGCGGG - Intergenic
1002498094 5:179629377-179629399 GATCACCTGAGCCTGGGTGGGGG - Intronic
1002878190 6:1229495-1229517 GGCCAGATGGGCCTGTGTGTGGG + Intergenic
1002932399 6:1643634-1643656 GACCACCTGGGCCACGGTGGGGG + Intronic
1003105295 6:3210680-3210702 GACCAGCTGTGCCAGTCTGTAGG + Intergenic
1003176660 6:3757268-3757290 GCCAAGCAGGGCCTTGGTGTGGG - Intergenic
1003945467 6:11071499-11071521 AATCAGCTGGGCCTGGTGGTGGG - Intergenic
1006010270 6:31037234-31037256 GTCCAGCTTGGCCTTGGTGAGGG + Intergenic
1006085129 6:31589817-31589839 GAGGTGCTGGGCCTTGGTGTCGG - Exonic
1006113341 6:31762011-31762033 GTCCTACTGGGCCTGGGTCTAGG + Intronic
1006504052 6:34476682-34476704 CCCCAGCATGGCCTGGGTGTTGG + Intronic
1006669357 6:35720119-35720141 GACCAGCTGCAGCTGGGGGTGGG - Intronic
1007721827 6:43889771-43889793 CTCCAGCTGGGCCTGGCTGCAGG + Intergenic
1007776290 6:44226229-44226251 GCCCAGCTAGGCCTGAGTGTGGG + Intronic
1008036320 6:46749156-46749178 GACCAGCAGGGCCTGGGCAGTGG - Intronic
1008285581 6:49645446-49645468 GACCAATTGGGCCTGGGAGGTGG + Intergenic
1013205240 6:107938840-107938862 GACTAGCTGGGCGTGGGCGGTGG - Intronic
1013227793 6:108132988-108133010 AAGCCACTGGGCCTGGGTGTAGG + Intronic
1013368613 6:109452566-109452588 GGCCAGCTGGGCAGGGGGGTTGG + Exonic
1014401526 6:120996278-120996300 GATCACCTGGGCCTGGGAGGCGG + Intergenic
1015417943 6:132970992-132971014 AATCAGCTGGGCATGGTTGTGGG - Intergenic
1015912509 6:138183112-138183134 GTCCAGCTGTGCTTGGGGGTTGG + Intronic
1016423534 6:143910899-143910921 AACCAGCTGGGCATGGTGGTGGG - Intronic
1016713976 6:147203652-147203674 GGCCTGCTGGGCCAGGGTGGGGG + Intergenic
1017013237 6:150079193-150079215 GATCACCTGGGCCTGGGAGGTGG + Intergenic
1018529797 6:164750560-164750582 GACCTGCCACGCCTGGGTGTTGG + Intergenic
1019184444 6:170212972-170212994 GACCAGTTGCGTCTGGGCGTGGG + Intergenic
1019491334 7:1314956-1314978 CCCCAGGTGGGCCTGGGTGTTGG - Intergenic
1019591825 7:1839451-1839473 GACAAGCTGGGCCTGGGGCGGGG + Intronic
1023966225 7:44964279-44964301 GAGCAGCTGGGCCTGGGCTGGGG + Intronic
1026829724 7:73603335-73603357 GACCAGCAGGGACTGGGGCTAGG - Intronic
1027216502 7:76187165-76187187 GCCCTGCTGGGCATGGATGTGGG + Intergenic
1027387942 7:77677072-77677094 GATCAGCTGGGTATGGTTGTGGG - Intergenic
1028908498 7:96181028-96181050 GACAGGCTTGGCCTGGGGGTTGG + Intronic
1032000598 7:128262730-128262752 GGCCAGCTGGGGCAGGCTGTGGG + Intergenic
1032534426 7:132650063-132650085 GAGCAGCTGGACCCAGGTGTTGG - Intronic
1033054373 7:138035943-138035965 GACCAGTTGAGCCTGGGAGGTGG + Intronic
1034933468 7:155182690-155182712 GACCTGCTGGGCTTGGTTGGGGG - Intergenic
1035241854 7:157537409-157537431 CACCAGCTGGGGCTTGGTGGTGG - Intergenic
1036798270 8:11771255-11771277 GAGCAGCTGTGGCAGGGTGTGGG - Intronic
1037682297 8:21107648-21107670 GATCAGGTATGCCTGGGTGTGGG + Intergenic
1037694108 8:21208569-21208591 TCGCAGCTGGGCTTGGGTGTGGG - Intergenic
1037784010 8:21891819-21891841 GAACAACTGGCTCTGGGTGTGGG - Intergenic
1038691492 8:29767802-29767824 GCTCAGCGGGGCCTGGGTGCAGG - Intergenic
1038977568 8:32717208-32717230 GACCAGCTAGTCCTGGTTTTGGG + Intronic
1039427092 8:37495101-37495123 GACATGCAGGGCCTGGCTGTGGG - Intergenic
1039984962 8:42439369-42439391 GACCAGCTGGGCCTGGGTGTGGG - Intronic
1040386175 8:46916396-46916418 AGCCAGCGGGGCCAGGGTGTGGG + Intergenic
1043016881 8:74949890-74949912 GACCAGCTGTGCCTGGGGTGAGG + Intergenic
1043393010 8:79809370-79809392 AATCAGCGGGGGCTGGGTGTGGG + Intergenic
1044679915 8:94766981-94767003 GACCACCTGAGCCTGGGAGGTGG + Intronic
1044871892 8:96627938-96627960 GATCACCTGGGCCTGGGAGGTGG - Intergenic
1047070370 8:121336461-121336483 GATTAGCTGGGCCTGGTGGTGGG - Intergenic
1047200299 8:122759800-122759822 TCCCAGCTGGGGCTGAGTGTAGG - Intergenic
1047833181 8:128658303-128658325 GTCCAGCTGGGCCCAGGTGAAGG - Intergenic
1048263530 8:132965604-132965626 TCCCCACTGGGCCTGGGTGTTGG + Intronic
1048878606 8:138855789-138855811 AAGCAGCTCTGCCTGGGTGTGGG - Intronic
1049098774 8:140564352-140564374 GAACAGCTGGGCCTGGGTTGGGG + Intronic
1049366433 8:142239042-142239064 CACCAGCTGGGCCTAGGGGTGGG + Intronic
1049432941 8:142573694-142573716 GATGAGCTGGGCCTGGGGGTTGG + Intergenic
1049466650 8:142754084-142754106 GCCCAGCCAGGCCTGGGTGAAGG + Intergenic
1049576913 8:143393790-143393812 GCCTGGCTGGGCCTGGGGGTGGG - Intergenic
1049641913 8:143719658-143719680 GAGCTGCTGGGGGTGGGTGTGGG + Intronic
1049657650 8:143805803-143805825 GAACTGCTGCTCCTGGGTGTTGG - Intronic
1049682830 8:143927324-143927346 CTCCAGCAGGGCCTGGGTGATGG + Exonic
1049709477 8:144057191-144057213 CCACAGGTGGGCCTGGGTGTGGG - Exonic
1050200514 9:3140484-3140506 GACCCTCTGGGCCTGAGTTTTGG - Intergenic
1053166381 9:35846656-35846678 GACCTGCTGGGCCTGTGGGCAGG + Intronic
1054959551 9:70952681-70952703 TAACAGCTGAGCATGGGTGTTGG + Intronic
1056550405 9:87648688-87648710 AACCAGGCAGGCCTGGGTGTAGG + Intronic
1056563833 9:87757070-87757092 GACCAGGTGGGGATGGGTGCAGG - Intergenic
1057271449 9:93653873-93653895 GACCAGCTGGACCTGGATCTGGG + Intronic
1058282057 9:103127895-103127917 TAACAGGAGGGCCTGGGTGTGGG + Intergenic
1058419397 9:104819971-104819993 GAGCAGATGGCCCTGGATGTTGG - Exonic
1059809213 9:117837579-117837601 AATTAGCTGGGCCTGGTTGTGGG - Intergenic
1061307326 9:129739662-129739684 GGGGAGCTGGGCCAGGGTGTAGG + Exonic
1062044590 9:134419132-134419154 GACCAGCCAGGGCTGGGGGTGGG - Intronic
1062137050 9:134934722-134934744 GAACCCCTGGGCCTGGGTGCTGG - Intergenic
1062212677 9:135373132-135373154 GAGCAACAGGGCCTGGGTGGAGG + Intergenic
1062657877 9:137613542-137613564 GACCAACTGGTCCTGGGAGGTGG + Intronic
1062710180 9:137971269-137971291 GACCGGCTGGGGCTGGGGGCAGG + Intronic
1185462279 X:338939-338961 CACCTTCGGGGCCTGGGTGTGGG + Intronic
1186789784 X:12985820-12985842 GATCATCTGAGCCTGGGAGTTGG - Intergenic
1187270721 X:17776843-17776865 AAGCAGTGGGGCCTGGGTGTGGG - Intergenic
1188298037 X:28473922-28473944 GATCAGATGGGGATGGGTGTAGG - Intergenic
1190877125 X:54467958-54467980 GCCCAGCTGGGCCTGGGGCTTGG + Intronic
1191737230 X:64399710-64399732 GATCACTTGGGCCTGGGAGTTGG - Intergenic
1192079113 X:68030721-68030743 AAGTAGCTGGGCCTGGGTTTTGG + Intergenic
1192212476 X:69136788-69136810 GCCTAGCTGGGTCTGGGTGGTGG - Intergenic
1192380560 X:70612046-70612068 GATCACTTGGGCCTGGGTGGGGG + Intronic
1193140393 X:78020638-78020660 GAGTAGCTGGGACTGTGTGTGGG + Intronic
1200797393 Y:7353580-7353602 AATCAGCTGGGCATGGTTGTGGG - Intergenic
1200829106 Y:7673363-7673385 GGGCAGCGGGGCCGGGGTGTGGG - Intergenic