ID: 1039996720

View in Genome Browser
Species Human (GRCh38)
Location 8:42541178-42541200
Sequence AGGAGGCGCCCGGCACTCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 90}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039996703_1039996720 20 Left 1039996703 8:42541135-42541157 CCCCTCCCCCGCCGAGTCCCACC 0: 1
1: 0
2: 0
3: 48
4: 471
Right 1039996720 8:42541178-42541200 AGGAGGCGCCCGGCACTCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 90
1039996705_1039996720 18 Left 1039996705 8:42541137-42541159 CCTCCCCCGCCGAGTCCCACCCC 0: 1
1: 0
2: 3
3: 71
4: 815
Right 1039996720 8:42541178-42541200 AGGAGGCGCCCGGCACTCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 90
1039996710_1039996720 9 Left 1039996710 8:42541146-42541168 CCGAGTCCCACCCCAAGCGCGCA 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1039996720 8:42541178-42541200 AGGAGGCGCCCGGCACTCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 90
1039996711_1039996720 3 Left 1039996711 8:42541152-42541174 CCCACCCCAAGCGCGCACAGCGG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1039996720 8:42541178-42541200 AGGAGGCGCCCGGCACTCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 90
1039996715_1039996720 -2 Left 1039996715 8:42541157-42541179 CCCAAGCGCGCACAGCGGAGCAG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1039996720 8:42541178-42541200 AGGAGGCGCCCGGCACTCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 90
1039996709_1039996720 12 Left 1039996709 8:42541143-42541165 CCGCCGAGTCCCACCCCAAGCGC 0: 1
1: 0
2: 1
3: 23
4: 201
Right 1039996720 8:42541178-42541200 AGGAGGCGCCCGGCACTCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 90
1039996713_1039996720 2 Left 1039996713 8:42541153-42541175 CCACCCCAAGCGCGCACAGCGGA 0: 1
1: 0
2: 0
3: 21
4: 61
Right 1039996720 8:42541178-42541200 AGGAGGCGCCCGGCACTCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 90
1039996704_1039996720 19 Left 1039996704 8:42541136-42541158 CCCTCCCCCGCCGAGTCCCACCC 0: 1
1: 0
2: 0
3: 27
4: 471
Right 1039996720 8:42541178-42541200 AGGAGGCGCCCGGCACTCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 90
1039996707_1039996720 14 Left 1039996707 8:42541141-42541163 CCCCGCCGAGTCCCACCCCAAGC 0: 1
1: 0
2: 1
3: 15
4: 211
Right 1039996720 8:42541178-42541200 AGGAGGCGCCCGGCACTCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 90
1039996714_1039996720 -1 Left 1039996714 8:42541156-42541178 CCCCAAGCGCGCACAGCGGAGCA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1039996720 8:42541178-42541200 AGGAGGCGCCCGGCACTCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 90
1039996716_1039996720 -3 Left 1039996716 8:42541158-42541180 CCAAGCGCGCACAGCGGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1039996720 8:42541178-42541200 AGGAGGCGCCCGGCACTCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 90
1039996708_1039996720 13 Left 1039996708 8:42541142-42541164 CCCGCCGAGTCCCACCCCAAGCG 0: 1
1: 0
2: 1
3: 10
4: 94
Right 1039996720 8:42541178-42541200 AGGAGGCGCCCGGCACTCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 90
1039996706_1039996720 15 Left 1039996706 8:42541140-42541162 CCCCCGCCGAGTCCCACCCCAAG 0: 1
1: 0
2: 2
3: 9
4: 176
Right 1039996720 8:42541178-42541200 AGGAGGCGCCCGGCACTCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039996720 Original CRISPR AGGAGGCGCCCGGCACTCGC AGG Exonic
901212690 1:7535328-7535350 TGGAGGCGGGCGGCACTCCCTGG - Intronic
907194622 1:52676476-52676498 AGGAGGCGCCCTGCACACAGTGG + Intergenic
910277567 1:85465118-85465140 AGGAGCCGACGGGCGCTCGCAGG - Exonic
911092550 1:94029455-94029477 GGGAGGCCCCCGGCACCCTCGGG + Exonic
915740250 1:158113675-158113697 AGGATGCGCCCGGCGCCCCCCGG + Intergenic
920095055 1:203481143-203481165 AGGAGGCTCCCAGCACTGGCGGG - Intronic
922821459 1:228488046-228488068 GGGAGGGGCCCAGCACACGCTGG - Intronic
1063462409 10:6223020-6223042 AGGAGGGGACTGGCACTCGGCGG + Intronic
1065019983 10:21495833-21495855 CGGAGGCGCCCGGCACCTGCAGG + Exonic
1065021956 10:21508859-21508881 AGCCGGCGCCCGGGACCCGCGGG + Intergenic
1065883615 10:30058838-30058860 GGGCGGCCCCGGGCACTCGCTGG + Intronic
1073578281 10:104642352-104642374 AGGGGGAGCCCGGCAGCCGCAGG - Intronic
1076624802 10:131815197-131815219 AGGAGGCCCCGGGCACCCACCGG - Intergenic
1077474596 11:2780399-2780421 AGCAGCCGCCCGGCCCTCGGAGG + Intronic
1084153816 11:67303274-67303296 AGGAAGCGCCCGGCCCGGGCCGG - Intergenic
1092446734 12:8564786-8564808 AGGAGGAGCCGGGCACTGACTGG + Intergenic
1096385983 12:51195848-51195870 AGGAAGCGCCCTGCACTCCCAGG + Intronic
1103596451 12:122027049-122027071 AGGAGGCGCGGGGCACACCCAGG + Intronic
1112344281 13:98577129-98577151 GGGACGCGCTCGGCGCTCGCGGG - Intronic
1114957722 14:27845381-27845403 AGGCTGCGCGCGGCACACGCAGG + Intergenic
1119720351 14:76885675-76885697 AGGAGGGGCCGGGCACTCCTGGG + Intergenic
1120214704 14:81669050-81669072 AGGCTGCGCGCGGCACTCACAGG - Intergenic
1122971855 14:105155461-105155483 AGGAGTCGCCCGGAGCTGGCTGG - Intronic
1122993135 14:105248382-105248404 AGGCGGCTCCCGGCGCTGGCAGG - Intronic
1129644713 15:77419759-77419781 AGGGGGCGCGCGGCACCGGCGGG + Intronic
1131621235 15:94070524-94070546 AGGTGGCGCCCTGCACCCGGCGG - Intergenic
1132604641 16:788595-788617 TGGCGGCGCCCGGCACGCTCGGG + Intergenic
1134174933 16:11998030-11998052 AGGATGCGCCCAGCACACGGTGG + Intronic
1142738591 17:1917420-1917442 TGGAGGCTCCCTACACTCGCTGG - Intergenic
1143462647 17:7114151-7114173 GTGAGGGGCCAGGCACTCGCAGG - Exonic
1143545480 17:7592783-7592805 CGGCGGCGCCTGGCACTTGCTGG + Exonic
1143968822 17:10777581-10777603 AGGAGGCAGCTGGCACTGGCTGG + Intergenic
1148751304 17:49947282-49947304 GGAAGGCGCCTGGCACTCGCTGG + Intergenic
1152462869 17:80450454-80450476 AGAAGGCTCCCGGCACTTACTGG + Intergenic
1152739386 17:82012365-82012387 AGGAGGGGCCTGGCAGGCGCTGG + Intronic
1153051600 18:906820-906842 CGAAGTCGCCAGGCACTCGCTGG + Intronic
1160397002 18:78580026-78580048 AGGAGGGGCCAGGCAGGCGCCGG - Intergenic
1160579156 18:79873795-79873817 AGGAGGCGCCTGGGACTTGGCGG + Intronic
1160734937 19:658176-658198 GGGTGGAGCCCGGCACTGGCAGG - Intronic
1166831486 19:45642156-45642178 CGGAGGCGCCCGGCCCTTGGGGG + Exonic
1167311237 19:48739086-48739108 CGGAGTCGCCCAGCACGCGCAGG + Exonic
1167497406 19:49827745-49827767 AGGAGGCCCCCGTCTCTGGCTGG + Intronic
926055525 2:9771750-9771772 AGGCAGCGCCCCGCACTGGCTGG + Intergenic
930071431 2:47369455-47369477 GGGAGGGGCCCGGGACTCGCGGG - Exonic
934479561 2:94622522-94622544 AGGCTGCGCGCGGCACACGCAGG - Intergenic
934795337 2:97094858-97094880 AGGACGCGCCCGCTTCTCGCTGG - Intronic
936141878 2:109947913-109947935 CGGAGGCGCCCGGCACCAGGAGG - Intergenic
936178566 2:110245861-110245883 CGGAGGCGCCCGGCACCAGGAGG - Intergenic
936202812 2:110423571-110423593 CGGAGGCGCCCGGCACCAGGAGG + Intronic
944464123 2:199983192-199983214 AGGAGGCTCCAGGCACTCCTTGG - Intronic
944656642 2:201882322-201882344 AGGAGGCTGCCTGCACTAGCGGG + Intronic
946463076 2:219887314-219887336 AAGAGGCAGCTGGCACTCGCTGG + Intergenic
948270939 2:236672691-236672713 AGGAGCCTCCCCTCACTCGCAGG - Intergenic
1180014978 21:45075528-45075550 TGCAGACGCCCGGCACCCGCAGG - Intronic
1180044927 21:45300967-45300989 AGGCGGCGCCCAGGACTCACTGG - Intergenic
1181032432 22:20154982-20155004 AGGGGGCGCCCGGGACACCCTGG + Intergenic
1181041373 22:20194212-20194234 AGGAGGTGCCCAGTACTTGCTGG + Intergenic
1181362936 22:22352814-22352836 AGGAGGGGCCCGGCAGTCCCTGG + Intergenic
1181365742 22:22375887-22375909 AGGAGGGGCCCGGCAGTCCCTGG + Intergenic
1181560368 22:23696511-23696533 AGGTGGCTCCCGCCACTCCCTGG + Intronic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1183862427 22:40679630-40679652 AGCAGGCGACCGGCACTGGCTGG + Exonic
1185206419 22:49541554-49541576 AGGAGCCGCCCTCCCCTCGCTGG - Intronic
957270977 3:78029954-78029976 GGGTGGCGCGCGGCCCTCGCAGG + Intergenic
961867067 3:129961280-129961302 AGGAGGAGCCCAGCACTTGATGG - Intergenic
968616329 4:1579266-1579288 AGGGGGCGCCCAGCAGGCGCGGG - Intergenic
971244098 4:24912962-24912984 CGGAGGCGCCGGGCCCTCTCGGG - Intronic
971477381 4:27084932-27084954 TGGTGGCGCCCGCCCCTCGCCGG - Intergenic
974958478 4:68672398-68672420 AGCGTGCGCCAGGCACTCGCTGG + Intergenic
979349429 4:119627938-119627960 AGGAGGCGCGCGGGACAAGCAGG + Intronic
985517479 5:354381-354403 GGGAGGCGCCCGGCACCCCAGGG - Intronic
985678085 5:1242594-1242616 AGGAGGGGCCCAGCCCTCCCAGG + Intronic
985903242 5:2813572-2813594 AAGAGGGGCCCGGCAGGCGCAGG - Intergenic
994923570 5:106084102-106084124 AGGTGGCTCCTGGCACTTGCAGG + Intergenic
997584122 5:135034540-135034562 ACGAGCCGCCCGGGACTCGCAGG - Intronic
998138507 5:139687144-139687166 AGGGGGCGCCTGGCAGGCGCTGG - Intergenic
999731254 5:154478064-154478086 AGGTGGCCCCCGGCAGTCTCTGG - Exonic
1002211787 5:177603834-177603856 AGGAGGCTCCTGTCACTTGCAGG - Intronic
1002786939 6:408742-408764 AGGAGGAGCCGGGGACTCCCAGG + Exonic
1003172678 6:3732707-3732729 AGATGGCGCCCGGCGCTAGCAGG - Intronic
1005303733 6:24494889-24494911 AGGAGGCGCCGGGGACGCGCGGG - Intronic
1005653135 6:27903273-27903295 AGCAGGCGCCCGCGACCCGCGGG - Intergenic
1009690911 6:67031103-67031125 GGGCTGCGCGCGGCACTCGCGGG + Intergenic
1016898771 6:149080013-149080035 AGCAGACCCCGGGCACTCGCAGG + Intergenic
1018400605 6:163415526-163415548 AGGGGGCGTCCGGCACCGGCGGG - Intronic
1019417947 7:935761-935783 TGGAGGTTCCCGGCACCCGCGGG - Intronic
1029291361 7:99504615-99504637 AGGTGGCGCGCGGGACTCGCCGG - Intergenic
1033899229 7:146115961-146115983 AGGAGGCGCGCGCCTCTCCCTGG - Intergenic
1035021635 7:155804128-155804150 AGGGTGCGCCCGGCGCCCGCGGG - Intronic
1035277605 7:157757454-157757476 AGGAGGACCCCGGCAGGCGCGGG + Intronic
1039996720 8:42541178-42541200 AGGAGGCGCCCGGCACTCGCAGG + Exonic
1040065315 8:43140345-43140367 CGGAGGCGCCCGGGAGCCGCGGG - Intergenic
1040304648 8:46205756-46205778 GGGAGGCTCCCAGCACTCCCTGG - Intergenic
1053678268 9:40461058-40461080 AGGCTGCGCGCGGCACACGCGGG + Intergenic
1054291344 9:63296595-63296617 AGGCTGCGCGCGGCACACGCGGG + Intergenic
1054506353 9:65915237-65915259 AGGCTGCGCGCGGCACACGCGGG - Intergenic
1057566323 9:96169001-96169023 GGGAGGCGCCGTGCACGCGCAGG - Intergenic
1059406045 9:114098726-114098748 AGAAGGGGCGGGGCACTCGCAGG + Intronic
1061449433 9:130660457-130660479 AGGAGGCGCGCGGAGCTCCCGGG + Intergenic
1062009830 9:134261034-134261056 GGGTGGCGCCGGGCACTCACTGG - Intergenic
1062580582 9:137227618-137227640 AGGAGGCGTCTGGCACTGTCTGG + Exonic
1185505526 X:630330-630352 AGGAAGCGCCCGGGTCGCGCCGG - Intronic