ID: 1039996837

View in Genome Browser
Species Human (GRCh38)
Location 8:42541613-42541635
Sequence GTAACCGTTTCCCGCGCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 13}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039996835_1039996837 -10 Left 1039996835 8:42541600-42541622 CCAGGTCCGCTCGGTAACCGTTT 0: 1
1: 0
2: 0
3: 1
4: 10
Right 1039996837 8:42541613-42541635 GTAACCGTTTCCCGCGCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 13
1039996830_1039996837 20 Left 1039996830 8:42541570-42541592 CCGGCAGGAAATGACGAAGGCAG 0: 1
1: 0
2: 1
3: 20
4: 234
Right 1039996837 8:42541613-42541635 GTAACCGTTTCCCGCGCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 13
1039996828_1039996837 24 Left 1039996828 8:42541566-42541588 CCGGCCGGCAGGAAATGACGAAG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1039996837 8:42541613-42541635 GTAACCGTTTCCCGCGCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 13
1039996827_1039996837 28 Left 1039996827 8:42541562-42541584 CCGACCGGCCGGCAGGAAATGAC 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1039996837 8:42541613-42541635 GTAACCGTTTCCCGCGCGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 13

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039996837 Original CRISPR GTAACCGTTTCCCGCGCGCC CGG Intronic