ID: 1039997123

View in Genome Browser
Species Human (GRCh38)
Location 8:42543010-42543032
Sequence TTTTAGATTGACAAACTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 439}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039997123_1039997125 2 Left 1039997123 8:42543010-42543032 CCTAAAAGTTTGTCAATCTAAAA 0: 1
1: 0
2: 3
3: 23
4: 439
Right 1039997125 8:42543035-42543057 AACCCCTAGTTGTAATATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039997123 Original CRISPR TTTTAGATTGACAAACTTTT AGG (reversed) Intronic
900894184 1:5471742-5471764 ATGTAGATTGATAAACCTTTTGG - Intergenic
901219845 1:7577322-7577344 TTGCAGATTAACAAACTTTAAGG + Intronic
901247318 1:7742685-7742707 TTGTAGAGTGATAACCTTTTAGG + Intronic
904067209 1:27762659-27762681 TTTTTGAATGAGAAGCTTTTAGG + Intronic
904074268 1:27828255-27828277 TGTTAGACTCAAAAACTTTTGGG + Intergenic
905451111 1:38057113-38057135 TTTTAAATTAACAATGTTTTTGG + Intergenic
906610406 1:47197887-47197909 TTTCAGATTGAGAAGCATTTCGG + Intergenic
906965847 1:50455817-50455839 TTTTTGATTAAAAAAATTTTGGG + Intronic
907199481 1:52714171-52714193 TTTTAGTTTGACAAGGTTTAGGG + Intergenic
907478584 1:54726107-54726129 TTATAGTTTGTTAAACTTTTTGG - Intronic
907827780 1:58035596-58035618 TTTTAGATTAATAAACAATTTGG - Intronic
908026940 1:59962269-59962291 TTATAGGTTTACATACTTTTAGG - Intergenic
908136955 1:61143105-61143127 TTTTAGAAGAACAAGCTTTTTGG + Intronic
908693334 1:66807457-66807479 TATTAGAATGTTAAACTTTTAGG + Intergenic
908751324 1:67426652-67426674 TTTTAAATTTAAAAAATTTTAGG + Intronic
909018956 1:70410577-70410599 CTCAAGATTGACTAACTTTTAGG + Intergenic
909047948 1:70732652-70732674 AATTAAATTGACAAACTTCTAGG - Intergenic
909402061 1:75244649-75244671 TTTTACATTAATAAACTTTGGGG + Intronic
909883109 1:80905080-80905102 TTCTATATTGATAATCTTTTAGG - Intergenic
909919494 1:81363406-81363428 TTTTTAATTGTCAAACTTTATGG - Intronic
911635270 1:100228242-100228264 TTGCAGAATGTCAAACTTTTTGG - Intronic
911810342 1:102268780-102268802 TTCCAGATTGGCAATCTTTTTGG + Intergenic
912357058 1:109062949-109062971 TTTTTGATTTAAAATCTTTTCGG - Intronic
912589369 1:110799546-110799568 TTTTAGAAGGAGAAACTATTCGG + Intergenic
913009186 1:114666070-114666092 TTTTAGCTTGGAAAACTGTTTGG - Intronic
913105032 1:115606443-115606465 TTATAAATGAACAAACTTTTGGG - Intergenic
914994214 1:152527271-152527293 TTTTTGTTTGTTAAACTTTTAGG + Intronic
917029608 1:170674593-170674615 TTTAAGATTTAGAGACTTTTGGG + Intronic
917314591 1:173711122-173711144 TTTTTGATTGAAAAACTATAAGG + Intergenic
918633077 1:186742612-186742634 AATTAGATTGAGAAGCTTTTTGG + Intergenic
918681466 1:187360192-187360214 TATTACTTTGAGAAACTTTTAGG - Intergenic
918782430 1:188718411-188718433 TTGTTGATTGATGAACTTTTGGG + Intergenic
918880500 1:190113438-190113460 TTTTAAATGGACTGACTTTTCGG - Intronic
918909774 1:190552064-190552086 TTTTAGTTTGAAATAATTTTAGG + Intergenic
919207855 1:194440105-194440127 TTTCAGCTTAAGAAACTTTTGGG - Intergenic
919662160 1:200257909-200257931 TTTTAGATTGAAAGGCATTTTGG - Intergenic
921476053 1:215611199-215611221 TTTTAGATTGAAAAGCTTCAGGG + Intronic
921720113 1:218462070-218462092 TTTTAGATAGACTTACATTTGGG + Intergenic
923844443 1:237713351-237713373 TTTTAGTTTGAGAAAATTTGTGG - Intronic
924248118 1:242105087-242105109 TTATACAGTGACAAACTATTTGG + Intronic
1062926573 10:1320300-1320322 TTTAAAATTCACATACTTTTGGG - Intronic
1064847891 10:19676461-19676483 TTTTATATTAAAAAACTTGTAGG - Intronic
1064945252 10:20780009-20780031 TTGTAAATTGATAAACTTTGCGG - Exonic
1067111047 10:43400372-43400394 CTTTAGATTGAAGAAATTTTAGG + Intronic
1068439897 10:57039306-57039328 TTGGAGATTGACAGACCTTTTGG - Intergenic
1068914362 10:62412543-62412565 TTTTAGCTTGAGAAGATTTTGGG - Intronic
1069207610 10:65711572-65711594 TTTTATTTTAAAAAACTTTTTGG + Intergenic
1070022149 10:72597100-72597122 TTTTAAATTAATAGACTTTTGGG - Intronic
1070355259 10:75633610-75633632 TATTAGAATGACAAATTTTCTGG - Intronic
1070985233 10:80683737-80683759 TTTTCGATTGACAACCCATTTGG + Intergenic
1071688244 10:87785711-87785733 TTTTAAATTGAGATATTTTTGGG - Intronic
1072348478 10:94532892-94532914 TTTGAGAATGACACACTTTCGGG + Intronic
1072502859 10:96035967-96035989 TGTTAGATGGACACACATTTAGG + Intergenic
1073732002 10:106299910-106299932 TTTCAGAGTGACAAATTCTTAGG - Intergenic
1074146969 10:110725529-110725551 ATTTAGATTGATGAACTTTAAGG + Intronic
1075703611 10:124485032-124485054 TTTTAGTTTTACAAACTGCTAGG + Intronic
1076088753 10:127659802-127659824 TTTTAAATTGGCATAATTTTTGG + Intergenic
1077276174 11:1709992-1710014 TTTTAGTTTGAAATAATTTTGGG - Intergenic
1077510356 11:2957058-2957080 TTTTAGATTCTAAAACTTTTAGG - Intronic
1079437243 11:20469589-20469611 TTTCAGATTTAGAAATTTTTTGG + Intronic
1079798106 11:24832958-24832980 ATTTAGTCTGACAAACTTTGTGG + Intronic
1080327787 11:31098279-31098301 TTTTAGATTGACTCAGTTTAAGG - Intronic
1081292284 11:41341561-41341583 TTTTAACATGACACACTTTTAGG - Intronic
1082911600 11:58382387-58382409 TTTGAAAATTACAAACTTTTGGG + Intergenic
1085622706 11:78049573-78049595 TTATACATTGGCAAACTTCTGGG + Intronic
1086073609 11:82825985-82826007 TTTTAGATGGACAAATTCTGTGG - Intronic
1086731405 11:90254651-90254673 TTTTAGATTGTCAAATTTGTTGG + Intergenic
1087862615 11:103179638-103179660 TTTTAGATTCACAGAATTTTAGG + Intronic
1088028362 11:105215090-105215112 GTTTACAGTTACAAACTTTTGGG - Intergenic
1088116089 11:106316551-106316573 TTTTAAACTGATAAACTTTCAGG + Intergenic
1088179298 11:107091287-107091309 TTTTAGATTGTCCAATTTGTTGG - Intergenic
1091514195 12:1161623-1161645 TTTTTGATTGAAAATCTTCTGGG - Intronic
1093098409 12:14998510-14998532 TTTTACATTCATAAACTTTCTGG - Intergenic
1093660832 12:21754503-21754525 TTTTAAGTAGACAAAGTTTTTGG + Intronic
1093878408 12:24376095-24376117 TTTTAGATTGTGCATCTTTTTGG - Intergenic
1094662904 12:32488452-32488474 TTTTAGATTAGAAAACTTGTGGG + Intronic
1095170563 12:39030306-39030328 ATTTAGATTGACAACCTCTAGGG + Intergenic
1095831709 12:46594175-46594197 TTTTAGATTGACACTCTGTGAGG - Intergenic
1096764773 12:53875856-53875878 TTTTGGATTGAATAAGTTTTAGG - Intergenic
1097366470 12:58719237-58719259 TTTTGTTTTGACAAGCTTTTCGG + Intronic
1097999832 12:65928675-65928697 TTTTTAATTTTCAAACTTTTTGG + Intronic
1098019764 12:66141790-66141812 TTTTAGATGCAGAAACATTTAGG - Intronic
1099274864 12:80561665-80561687 TTTGAGTTTGAGGAACTTTTTGG + Intronic
1099615447 12:84928817-84928839 TTTTAACTTGACTATCTTTTAGG - Intergenic
1100521197 12:95377645-95377667 TTTTAGATTGAAAAAATGCTAGG + Intronic
1100544492 12:95588494-95588516 TTTGAAATTGACAAAGATTTAGG + Intergenic
1101313409 12:103606618-103606640 TTTTAAGTTGACAATTTTTTTGG + Intronic
1102287117 12:111666930-111666952 TTTGAGTTTGACAAATTTATCGG + Intronic
1103694814 12:122806248-122806270 TTGTAGATTAACAAACTCGTAGG - Exonic
1104535298 12:129612907-129612929 TATTAGATTGACAAAACCTTTGG - Intronic
1105258775 13:18763357-18763379 TTTTAAATTCAGGAACTTTTAGG - Intergenic
1105394314 13:20014602-20014624 TTTTAAAATGACCAACTTTTGGG + Intronic
1105807769 13:23967069-23967091 TTTTAGGTTGACATACTCTGTGG - Intergenic
1106075640 13:26458682-26458704 TCTTAGATTGGCAAGCTTTGGGG + Intergenic
1107248276 13:38324276-38324298 TTTGAGAGTGAGAAACTTCTGGG + Intergenic
1107533209 13:41304209-41304231 TTGTGGACTGAGAAACTTTTTGG + Intergenic
1108229920 13:48326377-48326399 TTTGAGTTTGACAAATTTATTGG + Intronic
1108762333 13:53583563-53583585 TTTTTGATTGATGAACATTTGGG + Intergenic
1108999086 13:56773469-56773491 ATTTAGATTGACAGATATTTTGG - Intergenic
1109120949 13:58456374-58456396 TTTGAGATTGTTTAACTTTTTGG - Intergenic
1109147877 13:58804578-58804600 ATTTAAATTGTCAAACTTTAGGG + Intergenic
1109229016 13:59733350-59733372 TTTTAGATTGAAAGATTTTACGG - Intronic
1109605937 13:64695335-64695357 AACTAGATAGACAAACTTTTTGG + Intergenic
1109895876 13:68689094-68689116 TTTTATATTGATACATTTTTAGG + Intergenic
1109915008 13:68972173-68972195 TTTAACATTGAGAAACTTTAAGG + Intergenic
1110202632 13:72870783-72870805 ATTTAGGTTTACAAAATTTTTGG - Intronic
1110594446 13:77303578-77303600 TTTTTGATTGCCAAACATTTGGG - Intronic
1111266536 13:85822549-85822571 TTTTTGGTTGTCAATCTTTTTGG - Intergenic
1112188814 13:97154962-97154984 TTTTTGATTAAAAAACCTTTTGG + Intergenic
1112241905 13:97690205-97690227 TTTTAGGTTGACAAGTTTTGGGG - Intergenic
1112259562 13:97865713-97865735 TTTTAGCTTTACATACTTTAAGG - Intergenic
1113169885 13:107488887-107488909 TTTTAGCTTAAGAAGCTTTTGGG - Intronic
1114854899 14:26426944-26426966 GTTTTGATTAAAAAACTTTTTGG + Intergenic
1114855335 14:26432659-26432681 TTTTAGAGAAACAAACTTATAGG + Intergenic
1114885595 14:26845847-26845869 TTTTAAATTGACACATTTTCTGG + Intergenic
1114973977 14:28071148-28071170 TTTTAATTTTAAAAACTTTTTGG + Intergenic
1115088896 14:29550282-29550304 TTGTAAATTGACATACTTTCTGG + Intergenic
1116397746 14:44467153-44467175 TTTTAGATATACAGGCTTTTTGG - Intergenic
1117256355 14:53981829-53981851 CTTTAGATTGAAAGACTTGTGGG - Intergenic
1118243379 14:64083282-64083304 TTTAAAAATGACAAACTTTGGGG - Intronic
1118434124 14:65754017-65754039 CTTTGGATCGCCAAACTTTTGGG + Intergenic
1120256577 14:82127492-82127514 TTTTAGATTCATTATCTTTTTGG + Intergenic
1120348020 14:83315108-83315130 ATTTAAATTGACAAACGTTAGGG - Intergenic
1120766148 14:88327817-88327839 TTTTAAATAGAGAAACTTATAGG - Intergenic
1120966242 14:90170167-90170189 TTTTTGATTGACAATCATATGGG - Intronic
1120995423 14:90414660-90414682 TTGTAGAATGAAAAACTTCTGGG + Intergenic
1121069306 14:91002569-91002591 TTTTAGAATGAAAAGCTTTGGGG + Intronic
1122162517 14:99794385-99794407 TTTCCCATTAACAAACTTTTGGG - Intronic
1202884305 14_KI270722v1_random:89629-89651 TTTTTGATTCACATACTTTGAGG + Intergenic
1125193550 15:37020834-37020856 TTTTAGCTTAACAATATTTTAGG - Intronic
1125283087 15:38063990-38064012 TCTTGTATTGCCAAACTTTTTGG - Intergenic
1125952821 15:43767948-43767970 TTTTAGATTTTTAAATTTTTTGG - Intronic
1126313772 15:47346179-47346201 GTTTGGATTGACAAACTCATGGG + Intronic
1126323992 15:47455384-47455406 TTTTATTTTCACAAAATTTTTGG + Intronic
1126406011 15:48323397-48323419 TTTTACACTGACAAAAGTTTGGG - Intergenic
1127162242 15:56201423-56201445 TTATAGATTGAAATGCTTTTAGG - Intronic
1127230868 15:56993140-56993162 TTTCAGATTGCCCCACTTTTAGG - Intronic
1127690974 15:61397283-61397305 TTTTAATTTGTTAAACTTTTTGG - Intergenic
1128010505 15:64291093-64291115 TTATAAATTTACAAATTTTTAGG - Intronic
1128628591 15:69239001-69239023 TTGTACATTGAGAAACTTTCTGG + Intronic
1130552477 15:84899611-84899633 TTCTAGGTTGACAGCCTTTTGGG - Intronic
1131400617 15:92122753-92122775 TTTTACATTGACGGACATTTGGG - Intronic
1131494410 15:92893136-92893158 TTTATTATTGACAACCTTTTTGG + Intronic
1131879573 15:96848439-96848461 TTTTGGTTTCATAAACTTTTAGG + Intergenic
1135879757 16:26243002-26243024 TTCTAGATTGTCCAACTTATTGG - Intergenic
1137449537 16:48558069-48558091 TTTTGGAGTGACAAACATTTTGG - Intronic
1138066451 16:53946424-53946446 TTTTAGTTTAATAAACCTTTAGG + Intronic
1140558700 16:75951952-75951974 TTTTAGATGGGCAAAACTTTTGG + Intergenic
1143277786 17:5725751-5725773 TATTAGATTCATAAAATTTTAGG - Intergenic
1143800934 17:9380116-9380138 TTTTATATTTACAAACCTATAGG + Intronic
1144090075 17:11848287-11848309 TTTCATGTTGACAAACTATTTGG - Intronic
1145183290 17:20771798-20771820 CTTTAGATTGACAAATTGTTTGG + Intergenic
1146239683 17:31208367-31208389 TTTTAGAATAAGAAAATTTTAGG + Intronic
1146448546 17:32953020-32953042 TATTAGATATACATACTTTTGGG + Intergenic
1148177101 17:45576243-45576265 ACTTAGACTGACAAAATTTTGGG + Intergenic
1150748252 17:67834330-67834352 ACTTAGACTGACAAAATTTTGGG - Intronic
1151249715 17:72824674-72824696 TCTTAGATGGAGGAACTTTTTGG + Intronic
1152540823 17:80973786-80973808 TTTTACTTTTAAAAACTTTTTGG + Intergenic
1152673688 17:81625200-81625222 TTCTAGATTGAGAAACTATGTGG + Intronic
1153605930 18:6832198-6832220 TTTTTAATTTACAAATTTTTGGG + Intronic
1154078592 18:11231120-11231142 TTTTAGATTTAAAAATTATTGGG - Intergenic
1154973074 18:21429776-21429798 TTTGAAATTGACAAATTCTTAGG - Intronic
1154976459 18:21461967-21461989 GTTTAGATTAATAACCTTTTAGG - Intronic
1155010771 18:21775667-21775689 TTTTAAATTGTCAATTTTTTAGG + Intronic
1155827521 18:30466734-30466756 TTTTTGATTGACAGACATTTGGG + Intergenic
1156016986 18:32557863-32557885 CTGTAGATTGACAAACTGATGGG - Intergenic
1156759092 18:40565529-40565551 TTTTATTTTGATAAAGTTTTTGG + Intergenic
1156874625 18:41993927-41993949 CTTTAGAATTACAAACTTGTAGG + Intronic
1157015052 18:43701780-43701802 TTTCAGTTTGACAGAGTTTTTGG - Intergenic
1158099505 18:53814000-53814022 ATTTAGATTAATAAATTTTTAGG + Intergenic
1158179557 18:54698565-54698587 TTTTAGTTGGAAAATCTTTTTGG - Intergenic
1159093167 18:63871909-63871931 TTTAAGCTTGAAAAACATTTTGG + Intronic
1159262962 18:66039618-66039640 TTTTAGAATTGCAAATTTTTAGG - Intergenic
1159681776 18:71362727-71362749 TTTTAGATGATCATACTTTTAGG + Intergenic
1159875357 18:73804560-73804582 TTGTTGATTGATAGACTTTTGGG + Intergenic
1159876650 18:73819389-73819411 TCTTAGGTTGATAATCTTTTGGG - Intergenic
1162177956 19:8845885-8845907 TTTTAAAATAACAAATTTTTAGG + Intergenic
1162827453 19:13262307-13262329 TTTTTGAATGACAGGCTTTTGGG + Intronic
1163339727 19:16697648-16697670 TTTTAGAAATACAAAATTTTGGG + Intergenic
1163985640 19:20946292-20946314 TTTTTGATAGACAACCTGTTAGG - Intronic
1165566385 19:36732160-36732182 TTTCAGATTGAAAAACTCCTAGG - Intronic
1166246042 19:41526842-41526864 TTTTAGATTTTCAAATTTATTGG - Intergenic
1166476327 19:43128806-43128828 TTTTAGTTTGACAATATTGTGGG + Intronic
1166630683 19:44404085-44404107 TTTTAGATTGTGAAACATTTTGG + Intergenic
1167855495 19:52235326-52235348 TTTTAGATTGTCTAACTTGTGGG - Intergenic
1168362499 19:55753973-55753995 TTTTAAAATGACAAATCTTTCGG - Intergenic
1202633461 1_KI270706v1_random:21100-21122 TTTTTGATTCACATACTTTGAGG + Intergenic
1202659719 1_KI270708v1_random:56759-56781 TTTTTGATTCACATACTTTGAGG + Intergenic
925486858 2:4344663-4344685 TTTTACATGCACAAACCTTTTGG - Intergenic
927582279 2:24262863-24262885 ATTTAGAATGACTAAATTTTTGG - Intronic
927586686 2:24313839-24313861 TTTTATATTGAAACTCTTTTAGG - Intronic
927748485 2:25644453-25644475 TTTATGATTGAAAAAATTTTTGG + Intronic
928763170 2:34608743-34608765 TTTTAGATTTTCTAATTTTTTGG + Intergenic
929190185 2:39132699-39132721 TATTCTATTGATAAACTTTTGGG + Intergenic
931591733 2:63891425-63891447 TTTAAGATGAACTAACTTTTGGG - Exonic
932547362 2:72728060-72728082 ATCTATATTGTCAAACTTTTTGG - Intronic
932703737 2:74007834-74007856 TTTTAGTTTTGCAATCTTTTGGG - Intronic
932957552 2:76372090-76372112 TCATAGATTGACAAACCATTTGG + Intergenic
933075455 2:77919391-77919413 TTTTACTTTGTAAAACTTTTTGG - Intergenic
933401240 2:81798383-81798405 TTTTAGATGAACAAAGCTTTGGG + Intergenic
933444564 2:82363000-82363022 CTTGAGACTGAGAAACTTTTGGG - Intergenic
933633941 2:84686474-84686496 CTTTAAATAGACAAACATTTTGG + Exonic
935795711 2:106639713-106639735 TTTTAGATTTTTAAAGTTTTTGG + Intergenic
935853258 2:107246326-107246348 TTTTAGAAGGACAAAATATTGGG - Intergenic
937568371 2:123325295-123325317 TTCTAGATTATCTAACTTTTTGG + Intergenic
939241370 2:139564498-139564520 TTTTTTATTTAAAAACTTTTTGG - Intergenic
939257908 2:139768457-139768479 GTTTAGACAGACAAACTTCTGGG + Intergenic
940660373 2:156537957-156537979 TTTTATATTGACACATTTGTTGG + Intronic
940698245 2:157007994-157008016 TTTTAGATTTTCAAACTTGTTGG + Intergenic
941046788 2:160685125-160685147 TTTTGGCATGACAAACTTTAGGG + Intergenic
941257058 2:163245190-163245212 TTTTAGTTTGACAATTTATTAGG + Intergenic
942889769 2:180975249-180975271 TTTTAGATTTGCAAATTTTGAGG + Intronic
943141054 2:183982124-183982146 ATTTAGGTTGACACACTTTAGGG + Intergenic
943241297 2:185387541-185387563 TTTTATATTAACAAATTTTGTGG - Intergenic
943582078 2:189696373-189696395 TTTTAGGTTAAAAAACTTTATGG - Intronic
943855129 2:192779756-192779778 TCTTATATTGACAAACTCTTTGG - Intergenic
944140076 2:196446571-196446593 TTTTAATTTTACAAACTATTTGG + Intronic
944475149 2:200095926-200095948 TTTCAAATTGTCAAACTTGTTGG - Intergenic
944575240 2:201085060-201085082 TATTAGATTCACAATCTTGTAGG - Intronic
945140173 2:206677426-206677448 TTCTAAAATGACAAATTTTTTGG + Intronic
945413263 2:209538295-209538317 TTTTAGATTCATGAACTTTGTGG + Intronic
945826679 2:214729136-214729158 TTTCAGATTCATAAATTTTTTGG + Intronic
945882429 2:215340128-215340150 TTTTATATAGACAAGTTTTTGGG + Intronic
945904518 2:215576271-215576293 TTTTAAATTAATACACTTTTGGG + Intergenic
946122730 2:217530646-217530668 TTTTAGGTTGTCAACCTCTTGGG - Intronic
948032540 2:234830863-234830885 TTTTTGATTAAAAAAATTTTTGG - Intergenic
1169869043 20:10231708-10231730 TTTCAGATTGTGAAACATTTTGG - Intronic
1170052981 20:12167170-12167192 TTTTTTATTAAAAAACTTTTAGG + Intergenic
1170066856 20:12320494-12320516 TTGTAGATTCACATAGTTTTTGG - Intergenic
1170283140 20:14674052-14674074 TAATAGATTGACAACATTTTAGG - Intronic
1172418562 20:34793346-34793368 TTTAAACTTGACAAAGTTTTAGG + Intronic
1173835142 20:46119904-46119926 CTGGAGATTGACAGACTTTTAGG + Intronic
1174731326 20:52920928-52920950 CTTAAGATTGAAAATCTTTTTGG + Intergenic
1176599731 21:8780684-8780706 TTTTTGATTCACATACTTTGAGG + Intergenic
1176645676 21:9346964-9346986 TTTTTGATTCACATACTTTGAGG + Intergenic
1177117292 21:17101805-17101827 TTTTAGATTGTAATACTTTTTGG - Intergenic
1177351331 21:19945762-19945784 TATTAGCTTAAGAAACTTTTGGG + Intergenic
1177473384 21:21587214-21587236 TTTAAGATTGATAAACTTTTTGG + Intergenic
1178230464 21:30777881-30777903 TTTGGGATTGTGAAACTTTTAGG + Intergenic
1178511731 21:33210997-33211019 TTTTAAATTTACAGTCTTTTGGG - Intergenic
1179005916 21:37514323-37514345 TTTTAAATTGACCAATTTTGGGG + Intronic
1179038728 21:37783037-37783059 TTTGAGCTTGACAGTCTTTTGGG - Intronic
1179259785 21:39747635-39747657 TTTTAGGTGAACAAAATTTTAGG - Intronic
1179398852 21:41065612-41065634 TTTTTGATTGTCATACATTTAGG - Intergenic
1180327190 22:11440321-11440343 TTTTTGATTCACATACTTTGAGG + Intergenic
1180367253 22:11952190-11952212 TTTTTGATTCACATACTTTGAGG - Intergenic
1180418700 22:12794172-12794194 TTTTTGATTCACATACTTTGAGG - Intergenic
1181292975 22:21811784-21811806 TTTTTAATTTAAAAACTTTTTGG + Intronic
1182425979 22:30272835-30272857 TTTTCTATTGACAGACATTTGGG - Intergenic
949696874 3:6707683-6707705 TTGCAGATTTACAAAGTTTTTGG + Intergenic
952105896 3:30069113-30069135 TTTTAGGTTGCCACACTATTTGG - Intergenic
952318887 3:32257606-32257628 TTTTAGAATGACTAATTGTTGGG - Intronic
952540988 3:34367650-34367672 TTTGAGAAACACAAACTTTTAGG + Intergenic
953345560 3:42172474-42172496 ATTTAGATTGACAAGCATTGAGG - Intronic
953588190 3:44224137-44224159 TTTTAGATAAACAACTTTTTGGG + Intergenic
954017941 3:47711660-47711682 GTTTAGATTGACAAATTACTAGG - Intronic
954465672 3:50653281-50653303 ATTTGGATAGACAAACATTTAGG + Intergenic
954532887 3:51336171-51336193 TTTTAGACTGGCAAAACTTTAGG + Intronic
955714366 3:61813187-61813209 TTTTAGAATGAAAATCTTTGTGG + Intronic
956567657 3:70657215-70657237 TTTTAGGTTTACAAGCTTTCTGG - Intergenic
957698852 3:83682969-83682991 TTTTAAATTTATAGACTTTTTGG - Intergenic
958049424 3:88325302-88325324 TTAAAGATTTACAAAGTTTTGGG - Intergenic
958196670 3:90249756-90249778 TTTTAAATTCACAAACTGTAAGG - Intergenic
958753508 3:98221829-98221851 TTTTAGTTTGACAATTTTTCAGG - Intergenic
958780879 3:98540889-98540911 ATATAAATTTACAAACTTTTTGG - Intronic
958819627 3:98958236-98958258 TTTTTGCTTTCCAAACTTTTAGG - Intergenic
959128867 3:102326261-102326283 TTTTAAATTGAAAGACTGTTAGG - Intronic
959371170 3:105527876-105527898 TTTTAGGTTGAATGACTTTTAGG - Intronic
959642080 3:108651822-108651844 TATTCAATTAACAAACTTTTTGG - Intronic
960657848 3:120025740-120025762 TTTTAGGTTGACTAACTTTTAGG - Intronic
960757925 3:121037914-121037936 ATTTAGATTGTCAAATTTATTGG + Intronic
961354409 3:126326913-126326935 TTTTAGATTTACAAGCATTGCGG + Intergenic
961631286 3:128300791-128300813 TTTCAAATTGTCAAACTTCTGGG - Intronic
962257033 3:133879210-133879232 TTTTATTTTGACACAGTTTTAGG - Intronic
962448618 3:135492465-135492487 TTTTAAATGCACATACTTTTTGG - Intergenic
962502073 3:136005301-136005323 TTTTAGATTTAGAATTTTTTTGG - Intronic
963259949 3:143182115-143182137 TATCAGCTTGAGAAACTTTTGGG + Intergenic
963345087 3:144086471-144086493 TTTTAGATTGACTGAAATTTAGG - Intergenic
963487078 3:145948342-145948364 TCTTAGCTTAAGAAACTTTTGGG - Intergenic
963644690 3:147898912-147898934 TTTTAGATTTATAAGCCTTTTGG + Intergenic
963659687 3:148109507-148109529 TTTTACATTTTAAAACTTTTAGG - Intergenic
964576726 3:158178510-158178532 TTTTCGATATACCAACTTTTGGG + Intronic
965405923 3:168268601-168268623 ATTTAGATTGATAAATTATTAGG + Intergenic
965673653 3:171172930-171172952 TTTGAGAAATACAAACTTTTAGG - Intronic
1202741212 3_GL000221v1_random:58103-58125 TTTTTGATTCACATACTTTGAGG - Intergenic
968724295 4:2235477-2235499 TGTTAGATTGACAGACATTTAGG - Intronic
968738235 4:2311222-2311244 TTTTAAAATAACTAACTTTTGGG + Intronic
969855827 4:9998929-9998951 TTTTAATTTGGCATACTTTTGGG - Intronic
969947425 4:10798887-10798909 TTATAGATTGGCATGCTTTTGGG + Intergenic
970094511 4:12447494-12447516 TTTTAAATTAACACACATTTTGG + Intergenic
970189477 4:13499361-13499383 GTTTAGTTTGAAAAAGTTTTTGG - Intergenic
971547024 4:27898950-27898972 TTTCAGATTAGCAATCTTTTGGG + Intergenic
972009716 4:34162128-34162150 TTTTAGATTTTCCAACTTATTGG - Intergenic
972040989 4:34598659-34598681 ATTTAGAATGACTAAATTTTTGG - Intergenic
973081161 4:45995600-45995622 TTTTAGATTGAAAAAGCCTTAGG + Intergenic
973291811 4:48478276-48478298 TTTAAGAGTGGCATACTTTTTGG + Intergenic
973363088 4:49183105-49183127 TTTTTGATTCACATACTTTGAGG + Intergenic
973398006 4:49613754-49613776 TTTTTGATTCACATACTTTGAGG - Intergenic
973959760 4:56098006-56098028 TTATAGTTTTAAAAACTTTTTGG - Intergenic
974154204 4:58049743-58049765 TTTGACATTGACATACTTTGGGG + Intergenic
975009220 4:69328071-69328093 TTTTAAATCTCCAAACTTTTCGG - Intronic
975029960 4:69602437-69602459 TTTTAGAATAACAAAGATTTAGG + Intronic
975242562 4:72078870-72078892 TTTTAAAATGACAAAATTATAGG + Intronic
976843623 4:89461424-89461446 TTTTAGATTGAAAAATTTAAAGG + Intergenic
977172055 4:93775295-93775317 TTTTAGGTTGTCAAACATTTGGG - Intergenic
977201865 4:94125633-94125655 TTTTAGATTGAAGATCTGTTTGG + Intergenic
979200824 4:117975872-117975894 TTTATCATTGACAAAATTTTGGG - Intergenic
979788570 4:124749432-124749454 TTATAGATAAACAAAATTTTGGG - Intergenic
980254247 4:130356636-130356658 TTGAAGATTGAAAAACCTTTAGG + Intergenic
980585350 4:134806540-134806562 TTTTAGGTTGAAAAACATTTGGG + Intergenic
980692605 4:136314971-136314993 TTTTAGAATGACTAATTTGTTGG + Intergenic
980815867 4:137945535-137945557 CTATAGATTCACAAAGTTTTAGG + Intergenic
981085656 4:140680848-140680870 TTTTAGGAAGACAAATTTTTAGG - Intronic
981965128 4:150591254-150591276 TGTTATACTGACAAACATTTTGG + Intronic
982559718 4:156915168-156915190 GTTTAGATTTATAAAGTTTTGGG - Intronic
982910849 4:161140764-161140786 AATCAAATTGACAAACTTTTAGG + Intergenic
983447561 4:167873546-167873568 ATTCAGAGTGACAAACTATTTGG - Intergenic
983635986 4:169898462-169898484 TTTTAGAATGAAATACTTTAGGG + Intergenic
983920253 4:173336084-173336106 TTTTTGATTAACAAAATTCTGGG - Intergenic
984499736 4:180544704-180544726 TTTTAAATTAAAAAACATTTTGG + Intergenic
984963057 4:185116283-185116305 TTTTAGGCTGGCAAACTTCTAGG + Intergenic
986410168 5:7471242-7471264 TTTTAGAGTGACATAATTATTGG + Intronic
986577154 5:9224222-9224244 TTTTTAATTGTCATACTTTTTGG + Intronic
988481561 5:31635785-31635807 TTTTAAATTTTCAAACTTCTGGG + Intergenic
989417149 5:41192636-41192658 TTTTAGATTTTCAAATTTGTTGG + Intronic
989811274 5:45679046-45679068 TTTTAAATTTATACACTTTTAGG - Intronic
990917556 5:60926679-60926701 ATTTAGATTGATAAAATGTTTGG + Intronic
990934316 5:61131118-61131140 TTTTGTATTGACAAAGTTGTGGG + Intronic
991077797 5:62561130-62561152 TTTCAGATGGACCAGCTTTTGGG + Exonic
991109516 5:62882464-62882486 TTTTAGAGTGATAAAATATTAGG + Intergenic
991197116 5:63948147-63948169 TTTTGGAATGAAAAATTTTTAGG - Intergenic
992042135 5:72846139-72846161 TTTTAAATTCACATACTTTTTGG + Intronic
992733274 5:79693290-79693312 TTTTAGATTCAGAAACTGTCAGG + Intronic
993112404 5:83674475-83674497 TCTTCCAATGACAAACTTTTGGG - Intronic
993177419 5:84505188-84505210 TTTTAATTAGAGAAACTTTTTGG + Intergenic
993392656 5:87339864-87339886 TTGTAGATTGAAAAACCATTTGG + Intronic
994007984 5:94863158-94863180 GTTTATATTTACAAAATTTTAGG + Intronic
994105684 5:95945957-95945979 TTTCAGAGTGATAAACTTTTTGG - Intronic
994654780 5:102577974-102577996 TTTTATTTTGAGATACTTTTAGG + Intergenic
994985141 5:106923628-106923650 TTAAATATTGACAAACTTTCAGG + Intergenic
995172294 5:109129872-109129894 GTTTATAATGACAAATTTTTGGG + Intronic
996356699 5:122603499-122603521 TTTTAGAGTAACCATCTTTTAGG + Intergenic
996802929 5:127423354-127423376 TTTTAGCTTGATAAACTTCCTGG - Intronic
999613203 5:153393551-153393573 TTTTTGGTTGTCAAACTTTGTGG - Intergenic
999635862 5:153621628-153621650 TTTTTGAATGACAAACTAATGGG - Intronic
999869582 5:155735391-155735413 TATTAGTTTTTCAAACTTTTGGG - Intergenic
999942905 5:156563745-156563767 ATTTAGATTGAAAAACTTGAGGG - Intronic
1000200478 5:159005074-159005096 ATTTAGATGGACAAGCTTTCTGG + Intronic
1000542537 5:162558067-162558089 TTTTATATTGTCACACTTTGTGG + Intergenic
1001132314 5:169074481-169074503 TTATTAATTGAAAAACTTTTGGG - Intronic
1001150587 5:169224337-169224359 TTTTAAATGGACAAACCATTTGG - Intronic
1001700151 5:173700998-173701020 TTCTAGTTTTACAAACTTTCTGG - Intergenic
1001745139 5:174086787-174086809 TTTTAAAATGAAAAACATTTCGG + Intronic
1002154690 5:177267156-177267178 TTTTAGAACTACTAACTTTTCGG - Intronic
1003063898 6:2885840-2885862 TTTTAAATGGACATTCTTTTTGG - Intergenic
1003559232 6:7167316-7167338 TTTTAAATTGTCCAACTTGTGGG + Intronic
1003924058 6:10860392-10860414 TTTTAGATTTACAAAAAATTAGG + Intronic
1004610838 6:17237982-17238004 TTTTGAATTAATAAACTTTTGGG - Intergenic
1004984414 6:21064756-21064778 TTCTAGATTTACTAATTTTTAGG - Intronic
1006061235 6:31421435-31421457 TTTTAGCTTGACTAAGGTTTTGG + Intergenic
1008100705 6:47387829-47387851 GATAAAATTGACAAACTTTTAGG - Intergenic
1008144047 6:47867999-47868021 TTAAAGAGTAACAAACTTTTTGG + Intergenic
1008970945 6:57367423-57367445 TTTTAGGTTGATAAATATTTGGG + Intronic
1009056126 6:58337503-58337525 TTTTAAATTGCCAAATTTTGTGG + Intergenic
1009159907 6:60269225-60269247 TTTTAGGTTGATAAATATTTGGG + Intergenic
1009235055 6:61113095-61113117 TTTTAAATTGCCAAATTTTGTGG - Intergenic
1009279307 6:61726535-61726557 TATTAGATTAAGAAGCTTTTTGG - Intronic
1009506495 6:64487270-64487292 TTATACATTAACAAACATTTTGG - Intronic
1009625155 6:66129736-66129758 TTTCAGATTTACTGACTTTTGGG + Intergenic
1009675066 6:66808989-66809011 TTTCAGATTGACAACCTTTTTGG - Intergenic
1010548028 6:77183246-77183268 TTTTATAGTTAAAAACTTTTAGG - Intergenic
1010843193 6:80673012-80673034 TTTTAGATGGAAACACTTATTGG + Intergenic
1010855373 6:80831602-80831624 TATTTGATTTAAAAACTTTTAGG + Intergenic
1010905518 6:81482199-81482221 TTTTAGAGTGCAAACCTTTTTGG - Intergenic
1011117922 6:83915089-83915111 TTGTAGATTAATAAACTATTTGG - Intronic
1011384992 6:86786292-86786314 TTTTAAATTGAAAAAATTCTTGG + Intergenic
1011469975 6:87699046-87699068 ATTGAGATTGGCAAACTTGTGGG - Intronic
1011569876 6:88724083-88724105 TTTTTACTTTACAAACTTTTAGG - Intronic
1011707311 6:90014390-90014412 TTTTAAATTGTCAAATTTATTGG + Intronic
1011793763 6:90929835-90929857 TTTCAGATTGGCAAACATTTTGG + Intergenic
1012155802 6:95818744-95818766 TATCAGCTTGAGAAACTTTTGGG - Intergenic
1012555201 6:100503195-100503217 TTTTAGGTGAATAAACTTTTAGG + Intergenic
1013142942 6:107358028-107358050 TTTTGGATTGCGAAACATTTTGG - Intronic
1013484370 6:110582592-110582614 ATTAATATTGACAAACATTTTGG + Intergenic
1013804265 6:113979710-113979732 TATTAGATTAAAAAAATTTTTGG + Intronic
1014043818 6:116860787-116860809 TTTTAGATTGAAAGCCTTTCAGG - Intergenic
1014455435 6:121628294-121628316 TTTTCAATTGACTGACTTTTAGG + Intergenic
1016046750 6:139488598-139488620 TTTTAAATTGAGAAACTATCGGG + Intergenic
1017184368 6:151586306-151586328 TTTTAGCTTGCCAAACCTTTAGG - Intronic
1017290920 6:152735274-152735296 TTATAAATAGATAAACTTTTTGG + Intergenic
1018691383 6:166346780-166346802 GTTGAGATTTACAAACATTTGGG - Intergenic
1020942213 7:14554424-14554446 TTTCAAATTGATAAATTTTTAGG + Intronic
1021298443 7:18939165-18939187 GTTTATATTGAAAAAATTTTAGG - Intronic
1021327104 7:19286600-19286622 TTTTAAATTAACATATTTTTTGG + Intergenic
1021404578 7:20250202-20250224 GTTCAGATTGACAATCTGTTAGG - Intergenic
1021874921 7:25039595-25039617 TTATAGATTGTCCATCTTTTGGG + Intergenic
1022294138 7:29034040-29034062 TTTTAGATTGGCTATCTTCTAGG + Intronic
1022587683 7:31630820-31630842 GTTTTCATTGACATACTTTTTGG - Intronic
1022731232 7:33027990-33028012 TTATACAAAGACAAACTTTTGGG - Intronic
1023904112 7:44509246-44509268 ATTTAGATTGACAATCTATCAGG + Intergenic
1024067263 7:45750743-45750765 TTTTATTTTGAAAACCTTTTTGG - Intergenic
1027697240 7:81427031-81427053 TTTTAAAATTACAAACTTTTTGG - Intergenic
1027789873 7:82626310-82626332 TTTTAGATTAAAAATGTTTTAGG + Intergenic
1028176588 7:87667364-87667386 TTTCAGATGGAGGAACTTTTGGG + Intronic
1028824033 7:95248099-95248121 ATTTTCATTGACAAACTTTAAGG + Intronic
1029011846 7:97270361-97270383 TTTTAGACTAAGAACCTTTTTGG - Intergenic
1030247976 7:107406466-107406488 TAAGAGACTGACAAACTTTTAGG - Intronic
1033112933 7:138598626-138598648 TCTTAGCTTGACATCCTTTTAGG - Intronic
1033680591 7:143591321-143591343 TTTTAAATTTACAAATATTTAGG - Intergenic
1033704303 7:143870491-143870513 TTTTAAATTTACAAATATTTAGG + Intronic
1034072800 7:148203398-148203420 GTTTAGTATGACAAACTCTTTGG + Intronic
1035081669 7:156221376-156221398 TTTTAAAATGAGAGACTTTTAGG + Intergenic
1037003000 8:13744069-13744091 TTTTAGATTTACACACTATTTGG - Intergenic
1038074479 8:24056581-24056603 ATTTAGATTGATAAATTTATGGG - Intergenic
1038245826 8:25854993-25855015 TGTTAAATAGACAATCTTTTGGG + Intronic
1039283643 8:36014412-36014434 TTCTAGATTTATAAACATTTAGG - Intergenic
1039291859 8:36104376-36104398 TTTTCAATTTACAGACTTTTAGG - Intergenic
1039393206 8:37199472-37199494 ATTTAGATTTACAAACGTTTTGG - Intergenic
1039997123 8:42543010-42543032 TTTTAGATTGACAAACTTTTAGG - Intronic
1041653136 8:60321191-60321213 TTTTAGAATGCCAAACAATTGGG - Intergenic
1042766982 8:72332503-72332525 CATTATATTGACCAACTTTTTGG - Intergenic
1044648276 8:94467808-94467830 AGTTAGATTGACAAAATGTTTGG + Intronic
1046530026 8:115433102-115433124 CTTTATATTAACAAACTTTATGG - Intronic
1048672135 8:136734861-136734883 TTTTAAATTGGCAAAATGTTTGG + Intergenic
1048794290 8:138134542-138134564 TTTTAAATTGATGGACTTTTGGG + Intronic
1049984433 9:935406-935428 TTTTAATTTGACACACTCTTAGG + Intronic
1050216864 9:3336064-3336086 TTTTATAGTGACAAGCTTATTGG - Intronic
1051944671 9:22553820-22553842 TTTTAGAATGAGAGTCTTTTGGG + Intergenic
1053460124 9:38262237-38262259 TTTTAGATTGACATTATTTATGG + Intergenic
1055569016 9:77597758-77597780 TTTTCTATTAAAAAACTTTTAGG + Intronic
1055598435 9:77889913-77889935 TTTGACTTTGACAAACATTTCGG - Intronic
1056225115 9:84487450-84487472 TTTTAGATGGACATAGGTTTTGG + Intergenic
1056680768 9:88715881-88715903 TTTTAAACTGACAAACTTCAGGG + Intergenic
1058068706 9:100579585-100579607 TTAAAAATTCACAAACTTTTTGG + Intronic
1058481775 9:105403119-105403141 TTTTAGTTTAATAATCTTTTCGG - Intronic
1058929336 9:109703495-109703517 TTTTATAATGGCAAAATTTTTGG + Intronic
1059836053 9:118154464-118154486 TTTCAAAATGACAAAATTTTAGG - Intergenic
1059860389 9:118453861-118453883 TCTTATATAGATAAACTTTTAGG + Intergenic
1062636465 9:137494125-137494147 TTCTAGAATGAAAAACTTCTTGG + Intronic
1203748894 Un_GL000218v1:60988-61010 TTTAAGACTGATAACCTTTTGGG - Intergenic
1203709850 Un_KI270742v1:88029-88051 TTTTTGATTCACATACTTTGAGG - Intergenic
1186483720 X:9916594-9916616 TCTAATATTGACAAAGTTTTGGG - Intronic
1186790140 X:12989288-12989310 TTTTTAATTGTTAAACTTTTTGG + Intergenic
1186917614 X:14240399-14240421 TTTTAGATTTCCAGTCTTTTAGG + Intergenic
1187692551 X:21884265-21884287 TTTTAGGTAGACAATCATTTGGG + Exonic
1189573799 X:42328024-42328046 TTTCAGATTTAAAAGCTTTTAGG - Intergenic
1189579192 X:42387732-42387754 CTTTGGTTTGGCAAACTTTTGGG - Intergenic
1189898955 X:45686171-45686193 TTTCAGACTGACAGACTCTTAGG + Intergenic
1190718396 X:53124697-53124719 TTTTAGATTTCCAAATGTTTGGG + Intergenic
1191767315 X:64712252-64712274 TTTTAGATTGATGAACATTAAGG - Intergenic
1192390736 X:70725511-70725533 ATTTAGATTGAAAAAATATTGGG - Intronic
1192979271 X:76321537-76321559 TTTTAGATTTTCCAACTTATTGG - Intergenic
1193061996 X:77216569-77216591 TTTTATTTTGACATAATTTTAGG - Intergenic
1193200291 X:78681769-78681791 TTTTAGATTTGCAAATTCTTAGG - Intergenic
1193261773 X:79415718-79415740 TTTTTGACTGATAAACTCTTAGG + Intergenic
1193348829 X:80433601-80433623 TTTTAAATTGAGAACTTTTTGGG + Intronic
1193612193 X:83645688-83645710 TTTTAGAATGATTGACTTTTTGG + Intergenic
1194070779 X:89323226-89323248 TTCCAGATTAAAAAACTTTTGGG - Intergenic
1194821624 X:98514386-98514408 TTTTCCATTGAAAAACTCTTTGG + Intergenic
1195224839 X:102782259-102782281 TTTTAGATTTTCAAATTTATTGG + Intergenic
1196780481 X:119379118-119379140 TATTAGATGTACATACTTTTGGG - Intergenic
1197552185 X:127904925-127904947 TATTAGATCAAGAAACTTTTAGG - Intergenic
1198775081 X:140171100-140171122 TTTCAGATTGATAAAAATTTGGG - Intergenic
1199740849 X:150734878-150734900 TTCCAGTTGGACAAACTTTTGGG - Intronic
1201454721 Y:14157570-14157592 TTTTATATTTAAAAAATTTTTGG + Intergenic
1201950376 Y:19557178-19557200 GTTTAGATTGAAAATATTTTGGG - Intergenic