ID: 1039997125

View in Genome Browser
Species Human (GRCh38)
Location 8:42543035-42543057
Sequence AACCCCTAGTTGTAATATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039997123_1039997125 2 Left 1039997123 8:42543010-42543032 CCTAAAAGTTTGTCAATCTAAAA 0: 1
1: 0
2: 3
3: 23
4: 439
Right 1039997125 8:42543035-42543057 AACCCCTAGTTGTAATATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039997125 Original CRISPR AACCCCTAGTTGTAATATAT TGG Intronic
No off target data available for this crispr