ID: 1039997494

View in Genome Browser
Species Human (GRCh38)
Location 8:42546516-42546538
Sequence ATTATACTGTTCACGAAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039997488_1039997494 24 Left 1039997488 8:42546469-42546491 CCCCATGGCTGGGGGTTATGGAG 0: 1
1: 0
2: 0
3: 20
4: 168
Right 1039997494 8:42546516-42546538 ATTATACTGTTCACGAAGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 57
1039997490_1039997494 22 Left 1039997490 8:42546471-42546493 CCATGGCTGGGGGTTATGGAGTG 0: 1
1: 0
2: 0
3: 12
4: 179
Right 1039997494 8:42546516-42546538 ATTATACTGTTCACGAAGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 57
1039997489_1039997494 23 Left 1039997489 8:42546470-42546492 CCCATGGCTGGGGGTTATGGAGT 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1039997494 8:42546516-42546538 ATTATACTGTTCACGAAGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039997494 Original CRISPR ATTATACTGTTCACGAAGCC TGG Exonic