ID: 1039998989

View in Genome Browser
Species Human (GRCh38)
Location 8:42560720-42560742
Sequence CTCTTCACTGCTGAGAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039998989_1039998993 -1 Left 1039998989 8:42560720-42560742 CCTCCTCTCTCAGCAGTGAAGAG No data
Right 1039998993 8:42560742-42560764 GGTCTAGGCCTCAGCCGTTTTGG No data
1039998989_1039998997 30 Left 1039998989 8:42560720-42560742 CCTCCTCTCTCAGCAGTGAAGAG No data
Right 1039998997 8:42560773-42560795 TGCTGCCAAAGAGTCTATTTGGG 0: 147
1: 88
2: 34
3: 16
4: 211
1039998989_1039998996 29 Left 1039998989 8:42560720-42560742 CCTCCTCTCTCAGCAGTGAAGAG No data
Right 1039998996 8:42560772-42560794 CTGCTGCCAAAGAGTCTATTTGG 0: 145
1: 83
2: 41
3: 17
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039998989 Original CRISPR CTCTTCACTGCTGAGAGAGG AGG (reversed) Intergenic
No off target data available for this crispr