ID: 1040007300

View in Genome Browser
Species Human (GRCh38)
Location 8:42631216-42631238
Sequence CAGTGGTATGGGAGGCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040007300_1040007305 27 Left 1040007300 8:42631216-42631238 CCTCAGTGCCTCCCATACCACTG No data
Right 1040007305 8:42631266-42631288 TTGTTAAAGAAGCAATTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040007300 Original CRISPR CAGTGGTATGGGAGGCACTG AGG (reversed) Intergenic
No off target data available for this crispr