ID: 1040007651

View in Genome Browser
Species Human (GRCh38)
Location 8:42633633-42633655
Sequence CAGTGGTATGGGAGGCGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040007646_1040007651 9 Left 1040007646 8:42633601-42633623 CCTTGCACATTGATGAATTTCTG No data
Right 1040007651 8:42633633-42633655 CAGTGGTATGGGAGGCGCTGAGG No data
1040007645_1040007651 16 Left 1040007645 8:42633594-42633616 CCTAGGGCCTTGCACATTGATGA No data
Right 1040007651 8:42633633-42633655 CAGTGGTATGGGAGGCGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040007651 Original CRISPR CAGTGGTATGGGAGGCGCTG AGG Intergenic
No off target data available for this crispr