ID: 1040010393

View in Genome Browser
Species Human (GRCh38)
Location 8:42656745-42656767
Sequence CCCAAGACTTCATTTTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040010386_1040010393 21 Left 1040010386 8:42656701-42656723 CCAGGAAGTTCAAAAGAGACACC No data
Right 1040010393 8:42656745-42656767 CCCAAGACTTCATTTTCTTCTGG No data
1040010389_1040010393 -8 Left 1040010389 8:42656730-42656752 CCTCCAGGTTCCTTTCCCAAGAC No data
Right 1040010393 8:42656745-42656767 CCCAAGACTTCATTTTCTTCTGG No data
1040010388_1040010393 0 Left 1040010388 8:42656722-42656744 CCGATTCACCTCCAGGTTCCTTT No data
Right 1040010393 8:42656745-42656767 CCCAAGACTTCATTTTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040010393 Original CRISPR CCCAAGACTTCATTTTCTTC TGG Intergenic
No off target data available for this crispr