ID: 1040014286

View in Genome Browser
Species Human (GRCh38)
Location 8:42688733-42688755
Sequence TCTTACATACTGATGTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040014282_1040014286 6 Left 1040014282 8:42688704-42688726 CCCAGAGTGTTCTAAGGATGCCT No data
Right 1040014286 8:42688733-42688755 TCTTACATACTGATGTCAGAGGG No data
1040014281_1040014286 7 Left 1040014281 8:42688703-42688725 CCCCAGAGTGTTCTAAGGATGCC No data
Right 1040014286 8:42688733-42688755 TCTTACATACTGATGTCAGAGGG No data
1040014278_1040014286 27 Left 1040014278 8:42688683-42688705 CCCACACACATGAACACACACCC No data
Right 1040014286 8:42688733-42688755 TCTTACATACTGATGTCAGAGGG No data
1040014283_1040014286 5 Left 1040014283 8:42688705-42688727 CCAGAGTGTTCTAAGGATGCCTC No data
Right 1040014286 8:42688733-42688755 TCTTACATACTGATGTCAGAGGG No data
1040014279_1040014286 26 Left 1040014279 8:42688684-42688706 CCACACACATGAACACACACCCC No data
Right 1040014286 8:42688733-42688755 TCTTACATACTGATGTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040014286 Original CRISPR TCTTACATACTGATGTCAGA GGG Intergenic
No off target data available for this crispr