ID: 1040015542

View in Genome Browser
Species Human (GRCh38)
Location 8:42696236-42696258
Sequence GCTCAGGGTCCCGGGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040015535_1040015542 2 Left 1040015535 8:42696211-42696233 CCTGAGGAACAGACAGGGCTCAA No data
Right 1040015542 8:42696236-42696258 GCTCAGGGTCCCGGGGTCCTGGG No data
1040015534_1040015542 3 Left 1040015534 8:42696210-42696232 CCCTGAGGAACAGACAGGGCTCA No data
Right 1040015542 8:42696236-42696258 GCTCAGGGTCCCGGGGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040015542 Original CRISPR GCTCAGGGTCCCGGGGTCCT GGG Intergenic