ID: 1040016023

View in Genome Browser
Species Human (GRCh38)
Location 8:42700840-42700862
Sequence AATTTGACAAACTCACACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 204}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040016023_1040016024 -10 Left 1040016023 8:42700840-42700862 CCTCAGTGTGAGTTTGTCAAATT 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1040016024 8:42700853-42700875 TTGTCAAATTTTGCTAAAAGTGG No data
1040016023_1040016031 22 Left 1040016023 8:42700840-42700862 CCTCAGTGTGAGTTTGTCAAATT 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1040016031 8:42700885-42700907 TGGAGGTGGGAAGAGAGCAGGGG No data
1040016023_1040016029 20 Left 1040016023 8:42700840-42700862 CCTCAGTGTGAGTTTGTCAAATT 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1040016029 8:42700883-42700905 TATGGAGGTGGGAAGAGAGCAGG No data
1040016023_1040016027 8 Left 1040016023 8:42700840-42700862 CCTCAGTGTGAGTTTGTCAAATT 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1040016027 8:42700871-42700893 AGTGGATGTTGATATGGAGGTGG No data
1040016023_1040016026 5 Left 1040016023 8:42700840-42700862 CCTCAGTGTGAGTTTGTCAAATT 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1040016026 8:42700868-42700890 AAAAGTGGATGTTGATATGGAGG No data
1040016023_1040016025 2 Left 1040016023 8:42700840-42700862 CCTCAGTGTGAGTTTGTCAAATT 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1040016025 8:42700865-42700887 GCTAAAAGTGGATGTTGATATGG No data
1040016023_1040016028 9 Left 1040016023 8:42700840-42700862 CCTCAGTGTGAGTTTGTCAAATT 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1040016028 8:42700872-42700894 GTGGATGTTGATATGGAGGTGGG No data
1040016023_1040016030 21 Left 1040016023 8:42700840-42700862 CCTCAGTGTGAGTTTGTCAAATT 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1040016030 8:42700884-42700906 ATGGAGGTGGGAAGAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040016023 Original CRISPR AATTTGACAAACTCACACTG AGG (reversed) Intronic
901796461 1:11682165-11682187 AATTCGCCAAAATCACACAGTGG + Intronic
904761822 1:32810789-32810811 AATTGGACAAATTCACATTTTGG - Intronic
907678602 1:56542198-56542220 GCTTTGAAAAACTAACACTGGGG + Intronic
908042365 1:60128311-60128333 CACTTCACAAGCTCACACTGTGG + Intergenic
909097873 1:71312198-71312220 AATTTGAGAAATTGACACAGTGG + Intergenic
909685705 1:78346182-78346204 AATTTGACTACCTCACACACTGG + Intronic
911437971 1:97886927-97886949 AATTTAACTGAATCACACTGTGG + Intronic
911863915 1:102991698-102991720 ACCTTGCTAAACTCACACTGAGG - Intronic
913512169 1:119571896-119571918 TATTTGACAATGTCACTCTGTGG - Intergenic
913516393 1:119609067-119609089 TATTTGACAATGTCACTCTGTGG - Intergenic
915067274 1:153235714-153235736 AATAAGACAAACTCAAATTGAGG + Intergenic
915248877 1:154574516-154574538 AATCAGACAAACCCACACGGAGG - Intronic
918000850 1:180493861-180493883 AATTAGACAAATTCAAATTGAGG - Intronic
918698110 1:187569975-187569997 AATAGGACAAACTTATACTGTGG - Intergenic
918823241 1:189286626-189286648 AGTTTGACAAACACACAGTGTGG + Intergenic
918970232 1:191405370-191405392 AATCTGGCAACCCCACACTGAGG - Intergenic
919609110 1:199723218-199723240 AAATTCACAAACTCACAGAGGGG - Intergenic
921194733 1:212744521-212744543 AAATTAACAAACTGTCACTGAGG + Intronic
924044224 1:240011319-240011341 CATCTGACCAGCTCACACTGTGG + Intergenic
1064282710 10:13966281-13966303 AATTATACAAACTTACACTTTGG - Intronic
1064290386 10:14028667-14028689 AATGTGTCATAATCACACTGTGG - Intronic
1064678895 10:17789566-17789588 ATTTTGACATACTCTCACTGAGG - Intronic
1065067067 10:21980450-21980472 TATTAGACAAACCCAAACTGTGG + Intronic
1066998435 10:42584402-42584424 AATTTGACCACCACACCCTGGGG - Intronic
1068833500 10:61525187-61525209 CAGTTGACAAAAACACACTGGGG - Intergenic
1069295323 10:66836640-66836662 AATGTGACAAACCCACTATGTGG + Intronic
1070464001 10:76700487-76700509 CATTAGACAAACTCAAATTGAGG - Intergenic
1070757701 10:79003702-79003724 CATTTGACAAACTCTCCATGTGG + Intergenic
1071297553 10:84233139-84233161 AATCTGACAAGTTCACACTATGG + Intronic
1072509161 10:96101008-96101030 AAATTCCCAAAATCACACTGTGG + Intergenic
1075646108 10:124097582-124097604 AATTTGTCAAAGTCACAGAGTGG - Intergenic
1077843994 11:6004713-6004735 GATTTCTCAAATTCACACTGAGG - Intergenic
1080293250 11:30695530-30695552 AACTTCTAAAACTCACACTGGGG - Intergenic
1080546768 11:33327322-33327344 CATCAGACAAACCCACACTGAGG + Intronic
1085702080 11:78754612-78754634 GATTAAAAAAACTCACACTGTGG + Intronic
1089516832 11:119038164-119038186 AACTTGATAAATTAACACTGAGG + Intergenic
1091442755 12:524294-524316 AACTTGCCAAAGTCAAACTGAGG - Intronic
1091758245 12:3070049-3070071 AATTTGAAAAACACACAGTCTGG + Intergenic
1092912898 12:13164059-13164081 ACTTGCACAAGCTCACACTGGGG + Intergenic
1097044764 12:56179350-56179372 AATCTGACCAAATCACTCTGTGG + Intronic
1097853552 12:64437716-64437738 ACTTTGACTGACTTACACTGAGG - Intronic
1101907270 12:108836879-108836901 CATCAGACACACTCACACTGAGG + Intronic
1102849850 12:116231421-116231443 AATTAGACAAATTCAAAATGTGG + Intronic
1103270414 12:119668596-119668618 AATATGAGAAAGTCACCCTGAGG + Intronic
1106654581 13:31729007-31729029 AAATTGACAAGCTCATCCTGTGG + Intergenic
1106894197 13:34280396-34280418 AAACTGACAAACTGACACAGGGG + Intergenic
1107019310 13:35735362-35735384 AATTTTAGAAACTGACACTAAGG + Intergenic
1107869226 13:44731905-44731927 AATGTGACATACACACACAGTGG - Intergenic
1109696585 13:65968371-65968393 AAGTTGACAAACTCATACACTGG - Intergenic
1112779571 13:102883944-102883966 TATTTGACAAACTCATAATTAGG + Intergenic
1113490956 13:110691505-110691527 AATTTGATAGCCTCATACTGGGG - Intronic
1114973240 14:28060791-28060813 AATTTTACACACTAAAACTGAGG + Intergenic
1115295772 14:31825178-31825200 ATTCTTAAAAACTCACACTGTGG - Intronic
1116524721 14:45890631-45890653 AATATTAGAAACTCAGACTGTGG + Intergenic
1116553254 14:46269591-46269613 TATCAGACAAATTCACACTGAGG - Intergenic
1118425536 14:65656879-65656901 AAAGTCACAAACTTACACTGGGG + Intronic
1121930151 14:97964888-97964910 ATTTTGAGAATCACACACTGTGG + Intronic
1122913462 14:104844933-104844955 AGTGTGACAAATGCACACTGGGG + Intergenic
1123848667 15:24330751-24330773 CATCTGACAAATTCATACTGTGG - Intergenic
1123867724 15:24538273-24538295 CATCTGACAAATTCATACTGTGG - Intergenic
1124195088 15:27618242-27618264 AATCAGACAAACTCAAATTGAGG + Intergenic
1125234764 15:37500319-37500341 AATTTATAAAACTCACACTCGGG + Intergenic
1125252057 15:37715846-37715868 AATTTCTCAAATTCACACTCAGG - Intergenic
1125715245 15:41816096-41816118 CATCCGACAAACTCACATTGAGG + Intronic
1126686462 15:51252614-51252636 AGACTGACAGACTCACACTGTGG + Intronic
1130832233 15:87613110-87613132 AATTAGACAAATTCAGAATGTGG - Intergenic
1131455798 15:92581541-92581563 AATTTGAGAACCACAAACTGTGG + Intergenic
1140203443 16:72913415-72913437 CATCAGACAAACCCACACTGAGG - Intronic
1142569361 17:862837-862859 CATTTGACAAATTCAGACTCTGG + Intronic
1146735041 17:35231786-35231808 CAGTTGACAAACTGTCACTGGGG - Intergenic
1147255490 17:39178884-39178906 AATCACACAAACGCACACTGAGG + Intronic
1148393640 17:47291319-47291341 AATTTGAAAAACTTACAATTTGG + Intronic
1148976240 17:51531961-51531983 AAATTAAGTAACTCACACTGAGG - Intergenic
1149298243 17:55280740-55280762 TATTTGAGAGACTCACACTAAGG - Intronic
1149804613 17:59603905-59603927 AAACAGACAAACTCAAACTGAGG + Intronic
1150020812 17:61610674-61610696 AATTGTAAAAATTCACACTGGGG + Intergenic
1151346159 17:73503035-73503057 AACTGGACAAACCCACATTGAGG + Intronic
1154284733 18:13042142-13042164 TATTTGACAAACACAGTCTGTGG - Intronic
1157100118 18:44721694-44721716 AATATGACCCATTCACACTGTGG + Intronic
1157477349 18:48031799-48031821 AACTTGCCAAACTCACCCAGAGG + Intronic
1158160122 18:54472067-54472089 AATTTGACAAATTCAAAATTTGG - Intergenic
1158762769 18:60410392-60410414 ATTTTGACAAAGTCAGAATGTGG + Intergenic
1159537592 18:69735233-69735255 AATTTGACAAACAGACATTTAGG + Intronic
1159619995 18:70626198-70626220 AATTTATCAAAATCACATTGTGG + Intergenic
1159833041 18:73301788-73301810 AAATTGTCAAACTCAGAATGTGG + Intergenic
1161899818 19:7110052-7110074 AATTTAACAACCCCATACTGCGG + Intergenic
1164409112 19:27983180-27983202 ACTTAGAAAAACTCATACTGGGG - Intergenic
1164823322 19:31266462-31266484 AATCTGAGAAGTTCACACTGGGG + Intergenic
1166425336 19:42673085-42673107 AAGTTGATGACCTCACACTGTGG + Intronic
1167704657 19:51073039-51073061 AAGGTGATAAACACACACTGTGG - Intergenic
926332933 2:11840014-11840036 GATTTGAAAGACTCAGACTGTGG + Intergenic
931677318 2:64710266-64710288 AATTTGATAAACTTAGTCTGAGG - Intronic
932095009 2:68839624-68839646 TGTTTTTCAAACTCACACTGGGG - Intergenic
934962362 2:98687857-98687879 AACTTGACAGACTCACCCTGTGG + Intronic
939185323 2:138853715-138853737 GATATTATAAACTCACACTGTGG - Intergenic
939201198 2:139037185-139037207 AGTTTAACAAACTCACACCCTGG - Intergenic
941652318 2:168105482-168105504 AATTAGATAACATCACACTGTGG - Intronic
941822927 2:169860564-169860586 AAACAGAAAAACTCACACTGAGG - Intronic
942841146 2:180362368-180362390 AAGGTGACAAACTCACATTATGG - Intergenic
943141482 2:183988058-183988080 AATGTGATAAACAAACACTGTGG - Intergenic
945747882 2:213740973-213740995 AACTTTAAAAACTCACACTATGG - Intronic
947885956 2:233571587-233571609 CATTAGACAAACTCAAACCGAGG + Intergenic
947895614 2:233668970-233668992 CATCAGACAAACTCAAACTGAGG - Intronic
948196049 2:236097270-236097292 AACTTGAGAGACTCACACAGTGG + Intronic
948260016 2:236596903-236596925 ACTTTTTCAAACTCACACAGAGG - Intergenic
1168794019 20:599044-599066 AATATGACAAACTTAAAATGTGG - Intergenic
1170125300 20:12956583-12956605 AATTAGTCAAACTCAAACAGGGG - Intergenic
1172338821 20:34139354-34139376 AATTTGGCAAACAAAAACTGAGG + Intergenic
1172498379 20:35406106-35406128 AATTTAACAGCCTCAGACTGTGG + Intronic
1178773276 21:35525570-35525592 AATTTGAGGAACTCACAGTAAGG - Intronic
1180634177 22:17251193-17251215 AATTAGACAAATTCACAATGTGG + Intergenic
1184517724 22:44973011-44973033 ACTTTAACAAACTCCCACTCCGG + Intronic
1185101218 22:48841865-48841887 AATAAGACAAACCCTCACTGTGG - Intronic
1185103220 22:48852807-48852829 AATAGGACAAACCCTCACTGTGG + Intergenic
950917741 3:16663174-16663196 AATTTGACAGGCTCAGGCTGTGG - Intronic
952039579 3:29246128-29246150 AATTAGACAAACCCCCATTGAGG + Intergenic
952739184 3:36719355-36719377 ATTTTGACAAACTTACTCTGGGG - Intronic
954883778 3:53854518-53854540 CATCAGACAAACCCACACTGGGG - Intronic
956241107 3:67131502-67131524 TATCAGACAAACTCACACTGGGG - Intergenic
957963746 3:87295213-87295235 AATGTGACAAATGGACACTGGGG + Intergenic
959931638 3:111990201-111990223 AGTTTGACCATCTCATACTGTGG - Intronic
961020763 3:123504647-123504669 ACTATGACAAACTCAGACTCAGG + Intronic
962179214 3:133188083-133188105 AATTTGTCACATTGACACTGAGG + Intronic
962288129 3:134105771-134105793 TCTTTGACAAAATCCCACTGGGG + Intronic
962485668 3:135839872-135839894 AGTTTGAGATCCTCACACTGAGG + Intergenic
963101429 3:141609644-141609666 AAGTTGACAAACCCACAGAGAGG + Intronic
963172769 3:142267609-142267631 AATTGGACAAATCCAAACTGAGG + Intergenic
965561686 3:170067864-170067886 AATTAGCAAGACTCACACTGTGG - Intronic
966050035 3:175604654-175604676 AATTAGACAAACCCAAAATGAGG - Intronic
966343783 3:178955255-178955277 TATTTGACATACACACACCGTGG - Intergenic
966909697 3:184552164-184552186 AATTTAACAAAATAACACAGTGG + Intronic
967887323 3:194342056-194342078 AGTTTGCCAAACACACCCTGGGG + Exonic
970212832 4:13729129-13729151 AATTTAAAAAACTCTCACTTAGG + Intergenic
970310137 4:14773991-14774013 AAGTTGACAAAAACACACTGGGG + Intergenic
970342497 4:15121307-15121329 AATGGGAAAAACACACACTGGGG + Intergenic
971235248 4:24835923-24835945 AATTAGACTAACTAACAGTGGGG + Intronic
972992525 4:44838711-44838733 AAGTTGACAAAATCAAACAGTGG - Intergenic
973537373 4:51896872-51896894 AATTTTAAAAACCCTCACTGTGG + Intronic
974476192 4:62384369-62384391 AAATTGACAAACTCCTGCTGAGG - Intergenic
976543273 4:86302869-86302891 ACTTTTACAAATTCACAGTGAGG + Intronic
976545528 4:86330815-86330837 AATTTGACATAGTCATAATGGGG + Intronic
977196978 4:94075509-94075531 AATTTGAAAAATACACACTTTGG - Intergenic
978538069 4:109784235-109784257 CATTTGTCAAAGTCACAATGGGG - Intronic
979234053 4:118379213-118379235 AATCAGACAAACTGAAACTGTGG + Intergenic
985773698 5:1828593-1828615 AAACTGCCAAACTCACAGTGGGG - Intergenic
988361977 5:30248021-30248043 TATTTCACAAACTTACATTGTGG + Intergenic
989200142 5:38755047-38755069 ATTTTGACAAACACACAGTCAGG + Intergenic
990236832 5:53777974-53777996 AATGTGTCAAACTCTCACTTTGG - Intergenic
991173923 5:63663144-63663166 AATTTGCCAAACCCTCACTTAGG + Intergenic
992684027 5:79181783-79181805 ACTGTGGCAAAATCACACTGTGG + Intronic
995677851 5:114683561-114683583 AATTTGAAAAATTCAAACTGTGG + Intergenic
995897836 5:117035369-117035391 CATTTGACAAACTCATACCCTGG - Intergenic
996401468 5:123067972-123067994 AATTTTCCAAAGGCACACTGTGG - Intergenic
998059808 5:139111035-139111057 CATCTGACAACCTGACACTGTGG - Intronic
998188806 5:140004585-140004607 TATTAGACAAACTCAAGCTGAGG + Intronic
999311888 5:150556977-150556999 AATCTGACAAATTCAGAATGTGG - Exonic
999806529 5:155086537-155086559 AATTTGCCAAACTCACAGTTAGG - Intergenic
1000437125 5:161225758-161225780 AAGTGGAAAAACACACACTGGGG - Intergenic
1001782778 5:174384776-174384798 AATGTGACTGATTCACACTGGGG - Intergenic
1003056143 6:2822297-2822319 AATTTGACAAACTAATTCTAAGG - Intergenic
1004088575 6:12475769-12475791 AAATTGACATAGTCACACTTTGG + Intergenic
1004316913 6:14597322-14597344 AAATTTAAAAAATCACACTGAGG + Intergenic
1005260962 6:24059060-24059082 AATTTGACAAATGCATATTGAGG - Intergenic
1008373474 6:50763914-50763936 AATTTAACAAGCCCACACAGTGG - Intronic
1009599402 6:65779016-65779038 ACTTTTACAAACTGGCACTGTGG - Intergenic
1011344797 6:86357536-86357558 AATTAGAAAAACTCAAACTTTGG - Intergenic
1013656548 6:112252861-112252883 AATATGCCAACCTCTCACTGTGG - Intronic
1016197540 6:141364012-141364034 CATCTGACAAACTAAAACTGAGG - Intergenic
1017492211 6:154954754-154954776 TGTGTGCCAAACTCACACTGTGG + Intronic
1018941457 6:168310905-168310927 AATTTGCAAAAATCACATTGTGG - Intronic
1020341795 7:7119152-7119174 CATTAGACAAACTCAAACTAAGG + Intergenic
1020726060 7:11816252-11816274 AATTTGATTAACACAAACTGGGG + Intronic
1021469873 7:20989753-20989775 AGTTCAACAAACACACACTGAGG + Intergenic
1021959821 7:25860044-25860066 AATGTGACATACACACACAGGGG + Intergenic
1023895163 7:44427017-44427039 AATTAGACAAAATGACACAGTGG - Intronic
1024169698 7:46771398-46771420 AATGTGAAAAACTCAAACTGTGG - Intergenic
1024312756 7:47984676-47984698 AATATGACAAACTCCCAGTATGG - Intergenic
1024985946 7:55193277-55193299 GGCTTGACAAACACACACTGAGG + Intronic
1025624318 7:63206141-63206163 AATCAGACAAACTAAAACTGAGG - Intergenic
1025823833 7:64995211-64995233 AAGCTGACAAACTGACCCTGGGG - Intronic
1028276910 7:88868579-88868601 AATTTATTTAACTCACACTGTGG + Intronic
1030958330 7:115883727-115883749 AATTTAACAAACACACATCGTGG - Intergenic
1031033251 7:116758110-116758132 AATTAGACTAAGTCACTCTGGGG + Intronic
1031184630 7:118461025-118461047 AATTTTACAAATTCAAATTGAGG + Intergenic
1031189109 7:118523767-118523789 AATTTGACAAAAACAAACAGTGG - Intergenic
1032376276 7:131421729-131421751 AATTTGACAAAATTTCACTATGG + Intronic
1035573628 8:690246-690268 AATGTGACAAGCACAGACTGTGG - Intronic
1037063785 8:14549965-14549987 AAATTGATACAATCACACTGGGG + Intronic
1040016023 8:42700840-42700862 AATTTGACAAACTCACACTGAGG - Intronic
1044850011 8:96418860-96418882 TATTTGACATAAGCACACTGGGG - Intergenic
1045945722 8:107793873-107793895 AAGCTGAGAAACTTACACTGGGG + Intergenic
1048047027 8:130782224-130782246 AATTTGAAAATCTCACTCTATGG + Intronic
1048842143 8:138575823-138575845 AAATGAGCAAACTCACACTGAGG + Intergenic
1049119611 8:140722746-140722768 ACTTTTACAAACTCTGACTGAGG - Intronic
1050332567 9:4560366-4560388 ATTGTTACAAACTCACCCTGAGG - Intronic
1051011663 9:12422636-12422658 AATTTGAATTATTCACACTGTGG - Intergenic
1052570109 9:30209886-30209908 AATTTGAAAATCAAACACTGAGG - Intergenic
1052938807 9:34115686-34115708 AATTTTAGGAACTTACACTGAGG + Intronic
1055620401 9:78119555-78119577 TCTTTGATAAACTCACACTCCGG - Intergenic
1058338017 9:103857178-103857200 TATTAGACAAACCCAAACTGAGG + Intergenic
1058509744 9:105704575-105704597 AATCAGACAAACCCAAACTGAGG - Intronic
1059185298 9:112263523-112263545 CATCAGACAAACTCAAACTGAGG + Intronic
1059573610 9:115467006-115467028 ATTTTCACATTCTCACACTGGGG - Intergenic
1060505828 9:124197823-124197845 AATTTGAGAAACGCACACCAGGG + Intergenic
1061303013 9:129716999-129717021 AAATTGACAAGCACACACTGGGG - Intronic
1186019419 X:5237390-5237412 AATTTGACAACCTCCCTCTGTGG + Intergenic
1186336006 X:8589347-8589369 CACTTCACAAACTCACAGTGAGG - Intronic
1187188850 X:17013782-17013804 AAATTGACAAAGGAACACTGAGG - Intronic
1187316822 X:18203783-18203805 GATATGATAAACTCTCACTGAGG + Exonic
1188567888 X:31547331-31547353 AAATAGACAAACTAACAGTGTGG + Intronic
1193189888 X:78558012-78558034 AAGTGGAAAAACACACACTGGGG - Intergenic
1195978328 X:110551834-110551856 AATGTCAAAAAATCACACTGGGG + Intergenic
1196565742 X:117202856-117202878 AAGTCGACAAAAGCACACTGGGG + Intergenic
1197172848 X:123453760-123453782 AATTGGAAACATTCACACTGAGG - Intronic
1199313116 X:146344720-146344742 AATTTCAGACACTGACACTGAGG + Intergenic
1200406713 Y:2819287-2819309 AATGTGAGGAACTGACACTGGGG - Intergenic
1202083686 Y:21112335-21112357 AATGTGATTAACTCACATTGAGG - Intergenic