ID: 1040016028

View in Genome Browser
Species Human (GRCh38)
Location 8:42700872-42700894
Sequence GTGGATGTTGATATGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040016023_1040016028 9 Left 1040016023 8:42700840-42700862 CCTCAGTGTGAGTTTGTCAAATT 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1040016028 8:42700872-42700894 GTGGATGTTGATATGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040016028 Original CRISPR GTGGATGTTGATATGGAGGT GGG Intronic
No off target data available for this crispr