ID: 1040016782

View in Genome Browser
Species Human (GRCh38)
Location 8:42706614-42706636
Sequence CTAGGGGGCATTTGCTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040016782_1040016791 -5 Left 1040016782 8:42706614-42706636 CCCTCTGAGCAAATGCCCCCTAG 0: 1
1: 0
2: 1
3: 6
4: 126
Right 1040016791 8:42706632-42706654 CCTAGAGCCTGTGGGGTTCCAGG No data
1040016782_1040016797 30 Left 1040016782 8:42706614-42706636 CCCTCTGAGCAAATGCCCCCTAG 0: 1
1: 0
2: 1
3: 6
4: 126
Right 1040016797 8:42706667-42706689 CTCTTTACAGACTGACACCCTGG No data
1040016782_1040016792 -1 Left 1040016782 8:42706614-42706636 CCCTCTGAGCAAATGCCCCCTAG 0: 1
1: 0
2: 1
3: 6
4: 126
Right 1040016792 8:42706636-42706658 GAGCCTGTGGGGTTCCAGGAAGG No data
1040016782_1040016794 7 Left 1040016782 8:42706614-42706636 CCCTCTGAGCAAATGCCCCCTAG 0: 1
1: 0
2: 1
3: 6
4: 126
Right 1040016794 8:42706644-42706666 GGGGTTCCAGGAAGGTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040016782 Original CRISPR CTAGGGGGCATTTGCTCAGA GGG (reversed) Intronic
900644100 1:3701194-3701216 CTCGGGGGCAGGTGCTCACAGGG - Intronic
900733123 1:4276059-4276081 TCACTGGGCATTTGCTCAGAGGG - Intergenic
903670495 1:25032679-25032701 CTAGGGAGTCTGTGCTCAGATGG - Intergenic
905371702 1:37485934-37485956 GTAGGTGGTATTTGCTCACAGGG + Intergenic
908003319 1:59703058-59703080 GTAGGGAGCCTCTGCTCAGAGGG + Intronic
913941688 1:125115519-125115541 CTACAGAGCATTTGCTCACATGG - Intergenic
914827163 1:151144763-151144785 CTAAGGCGCTTTTGCTAAGAAGG - Intronic
916246594 1:162694369-162694391 CTAAAGGGCCTTTCCTCAGAGGG - Intronic
920230169 1:204464937-204464959 CTGGGGTGCATTTGCTCTTAAGG + Intronic
922747618 1:228054001-228054023 CTAGGGGCCATTTGCTGACCTGG + Intronic
924257492 1:242197018-242197040 AGAGGGGGCATTTACTCAGGAGG - Intronic
924708723 1:246517919-246517941 CTGGCGCTCATTTGCTCAGAGGG - Intergenic
1063672906 10:8114221-8114243 CTAGGGAGCATTTGCTCTTCAGG + Intergenic
1064251492 10:13709752-13709774 CTGAGGGCCCTTTGCTCAGAAGG + Intronic
1064602367 10:17006934-17006956 CTAAGGGGCATGTGATCAGGAGG - Intronic
1065942635 10:30578753-30578775 CTAGGGCTCATGTGCTCAGAAGG + Intergenic
1066951007 10:42116003-42116025 CTACAGAGCATTTGCTCACATGG + Intergenic
1074967620 10:118505696-118505718 TTAGTGGGCACTTGCTGAGATGG + Intergenic
1075911177 10:126126994-126127016 CCAGGTGGCATCTGCTCTGAAGG - Intronic
1078447296 11:11413856-11413878 TTAGGGGGCATTTGGATAGATGG - Intronic
1086439485 11:86814040-86814062 CCAGGTGCCATTTGCTGAGATGG + Intronic
1089043778 11:115480921-115480943 GGAGGAGGCATTTGCTGAGAGGG - Intronic
1090837968 11:130467024-130467046 CTAGGGAGTAATTGCTCTGAGGG + Intronic
1097185590 12:57194759-57194781 CAAGGGGGCATTTGCTGGGGGGG - Intronic
1098818060 12:75193442-75193464 CTATGGGACAACTGCTCAGAAGG + Intronic
1101733155 12:107443205-107443227 GTGGGATGCATTTGCTCAGAAGG + Intronic
1104140711 12:125983848-125983870 CTGTGGGGCATTTGCTCTGCTGG + Intergenic
1104959697 12:132482791-132482813 CTAGGGAGCATATGCTCACAGGG + Intergenic
1107656306 13:42595170-42595192 CTAGGTGGCAGTATCTCAGAAGG + Intronic
1107886842 13:44880739-44880761 CTAGGGGAAAATTGCTTAGAAGG + Intergenic
1111821388 13:93219939-93219961 TTAGAAGGCACTTGCTCAGAAGG - Intergenic
1118511520 14:66479751-66479773 CTAGAGGGGATTTGCCTAGAGGG + Intergenic
1120124873 14:80729530-80729552 CTACGGGGCATCTACCCAGAGGG - Intronic
1121688608 14:95858240-95858262 CTAGGATGCATTTGCTGAGTGGG - Intergenic
1121978514 14:98430162-98430184 CTATGGGGGATTTTCTCCGAGGG + Intergenic
1123759611 15:23422350-23422372 CTAGGGATCCCTTGCTCAGAGGG - Intergenic
1135489530 16:22897143-22897165 CTGGGGGACATTTGAGCAGAAGG - Intronic
1136797373 16:33031892-33031914 CTACAGAGCATTTGCTCACATGG + Intergenic
1136939176 16:34504102-34504124 CTACAGAGCATTTGCTCACATGG + Intergenic
1136960644 16:34844459-34844481 CTACAGAGCATTTGCTCACATGG - Intergenic
1137084766 16:36105301-36105323 CTACAGAGCATTTGCTCACATGG + Intergenic
1140266029 16:73421937-73421959 CTTGTAGGCCTTTGCTCAGATGG - Intergenic
1140633940 16:76888397-76888419 CTTGGGGGCATCTTCCCAGATGG - Intergenic
1141432424 16:83977338-83977360 CTTGCTGGCATTTGCTCAGCAGG + Intronic
1141836814 16:86545994-86546016 CCAGGGGGCCCTTGCTAAGAGGG - Intronic
1143845264 17:9768995-9769017 CTAGGGAGCATTTAGTCAGAGGG + Intergenic
1145326832 17:21839224-21839246 CTACAGAGCATTTGCTCACATGG - Intergenic
1145689807 17:26728402-26728424 CTACAGAGCATTTGCTCACATGG - Intergenic
1145693669 17:26770656-26770678 CTACAGAGCATTTGCTCACATGG - Intergenic
1146256890 17:31396937-31396959 ATAGCAGGCATTAGCTCAGAGGG - Intronic
1147118994 17:38324331-38324353 CTGGAGGCCATTTGCTCAGCTGG - Intergenic
1148106908 17:45123838-45123860 CGAGTGGGCATTCACTCAGAGGG - Intronic
1148559932 17:48600174-48600196 CTAGGGGCCATTTGAACAGGGGG + Intronic
1151057528 17:71050580-71050602 TTAGAGGTCATTTCCTCAGAAGG - Intergenic
1203191013 17_KI270729v1_random:189805-189827 CTACAGAGCATTTGCTCACATGG - Intergenic
1155682891 18:28511563-28511585 CTAGGAGGCATCTGCTCTGCTGG - Intergenic
1160804749 19:987587-987609 CTAGGATGCAGTTGCTGAGAGGG + Intronic
1162861852 19:13511788-13511810 TTAGTGGGCATTTGCCAAGAAGG - Intronic
1164696137 19:30245794-30245816 CTCGGGGGCCTTTTCTCTGAAGG + Intronic
1202669257 1_KI270709v1_random:36241-36263 CTACAGAGCATTTGCTCACATGG - Intergenic
925714527 2:6772263-6772285 CTAGGGGGACTTTGGCCAGAGGG + Intergenic
927989952 2:27441017-27441039 CTAGGGAGCATTTTCTCTAAAGG - Intronic
928650280 2:33396724-33396746 CTAGTAAGCATTTGCTAAGAAGG - Intronic
929824067 2:45296303-45296325 CTATGGGGCATTTGCACATGGGG + Intergenic
930109473 2:47666305-47666327 CTTGGATGCATTTGCTGAGAAGG - Intergenic
934252039 2:90363606-90363628 CTACAGAGCATTTGCTCACATGG + Intergenic
934257402 2:91439350-91439372 CTACAGAGCATTTGCTCACATGG - Intergenic
934331036 2:92069909-92069931 CTACAGAGCATTTGCTCACATGG - Intergenic
938516519 2:132012968-132012990 CTACAGAGCATTTGCTCACATGG + Intergenic
939091878 2:137789569-137789591 TTAGGAGGCATTTGCTCCCAGGG - Intergenic
940506136 2:154555670-154555692 CTAGGAGTCATTTGCTCAGTAGG - Intergenic
943546786 2:189290428-189290450 CAAAGGAGCATTTGCTGAGATGG + Intergenic
948323333 2:237089874-237089896 CTTGGGGGAATTTGGTCAGTAGG + Exonic
948561359 2:238855798-238855820 CTAGATGACCTTTGCTCAGAGGG - Intronic
948656923 2:239482023-239482045 CTAGGGCAGATTTGCCCAGAGGG + Intergenic
1169568541 20:6882053-6882075 CTAGGGGGTATTGCCTCAGCAGG - Intergenic
1169631518 20:7637918-7637940 AGAGGAGGCATCTGCTCAGATGG - Intergenic
1173840192 20:46151998-46152020 CTAGGGGTCATGGGGTCAGAGGG + Intergenic
1176814827 21:13589197-13589219 CTACTGGGTATTTGCTCAAAGGG - Intergenic
1178884952 21:36477773-36477795 CTCTGGGCCATTTGCTGAGAGGG - Intronic
1182312060 22:29416292-29416314 CCGGTGGGCATTTGCTCAGCAGG - Intronic
1182688201 22:32136951-32136973 CCGGTGGGCATTTGCTCAGCAGG + Intergenic
1184714368 22:46272530-46272552 CAGGGTGGCATTTGCACAGAGGG + Intronic
954570389 3:51636259-51636281 CTAAGGGGCCTTTGCTCATTTGG + Intronic
955429221 3:58824998-58825020 CTTTGGGGCATCTGCTCACAGGG + Intronic
956334206 3:68145214-68145236 CTTGGGGGAATTTGGTCAGTAGG + Intronic
957794004 3:84979032-84979054 CTAGAGGTCAGTTACTCAGAGGG + Intronic
961644821 3:128387204-128387226 CTGGGGGGCTTTGGCTCAGGAGG + Intronic
962115985 3:132508213-132508235 CTAGGGGGGATTGGCTCATGAGG + Intronic
965427931 3:168550432-168550454 CAAGGTAGCATTTGCTCAAAGGG - Intergenic
966317816 3:178668266-178668288 ATAGGAAGCTTTTGCTCAGAGGG + Intronic
966588580 3:181654117-181654139 TTAGGTGGCATCTGTTCAGAAGG - Intergenic
967114486 3:186324263-186324285 CTAGGGTGAAATAGCTCAGAAGG - Intronic
968745938 4:2360087-2360109 CTAGGGGCCATGGGCTCTGACGG + Intronic
975992159 4:80268251-80268273 CTGTGGGGCTTTTGCTCAGTAGG + Intronic
976198077 4:82552399-82552421 CCAGGGCCCATTTGCTCAGTAGG - Intronic
977910057 4:102523846-102523868 CTGGTGAGCATTTGGTCAGATGG + Intronic
978486908 4:109264718-109264740 CTTGGGGGAATTTGATCAGTGGG - Intronic
979740504 4:124144222-124144244 ATAGGGTGCATTTGATTAGAGGG + Intergenic
981042904 4:140239173-140239195 CTCGGGGGCACTTGCTGGGAAGG + Intergenic
981517485 4:145625419-145625441 CAAGGAGCCATTTGCTGAGAGGG + Intronic
982765445 4:159342620-159342642 CTAGAGGATATTTGCTCAGTCGG + Intronic
985525794 5:401088-401110 CTGGGGGGCATCTGCTGAAAGGG - Intronic
985631977 5:1018568-1018590 CTCAGGGGCTTGTGCTCAGATGG + Intronic
986463608 5:7998280-7998302 CAACAGGGCATTTGCTCTGAGGG + Intergenic
990475944 5:56162054-56162076 CTAGGGCCCATTTGGTCTGAGGG + Intronic
996685894 5:126280305-126280327 CTTGGGGCCCTGTGCTCAGAAGG - Intergenic
999636091 5:153624238-153624260 CCTGGGGACAATTGCTCAGATGG - Intronic
1001434626 5:171689440-171689462 TTAGGGGGCATTTCCTCCTAGGG - Intergenic
1018673897 6:166202442-166202464 CTAGCGGGCTTCTGCTCAGATGG + Intergenic
1019515935 7:1440191-1440213 GGAGGTGGCATTTGCTCAGAAGG - Intronic
1023659317 7:42456500-42456522 TTATAGGGCACTTGCTCAGAAGG - Intergenic
1024229437 7:47353012-47353034 CTTGGGGACATTTCCTCAGGCGG + Intronic
1024806927 7:53152406-53152428 CTACAGAGCATTTGCTCACATGG + Intergenic
1025319769 7:58083790-58083812 CTACAGAGCATTTGCTCACATGG - Intergenic
1025553945 7:62279683-62279705 CTACAGAGCATTTGCTCACATGG + Intergenic
1025560835 7:62373591-62373613 CTACAGAGCATTTGCTCACATGG - Intergenic
1032765110 7:134984426-134984448 CTAGGGGGCATTTGAGCAGAGGG - Intergenic
1037251102 8:16895199-16895221 ACATTGGGCATTTGCTCAGAGGG - Intergenic
1040016782 8:42706614-42706636 CTAGGGGGCATTTGCTCAGAGGG - Intronic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1042260785 8:66857235-66857257 CTATGGGGGATTTTCTCATATGG + Intronic
1045108734 8:98919484-98919506 CTAGGGGGGATTGACTGAGAAGG + Intronic
1045408331 8:101890382-101890404 ATAGGAGTGATTTGCTCAGAGGG - Intronic
1049212739 8:141394239-141394261 CCAGGTGGCATTTGGCCAGAGGG + Intronic
1053886914 9:42650381-42650403 CTCGGGGGCAGATGCTGAGATGG + Intergenic
1054225933 9:62457831-62457853 CTCGGGGGCAGATGCTGAGATGG + Intergenic
1055180493 9:73380571-73380593 CTAGGGGCCATTGCTTCAGAGGG - Intergenic
1057115672 9:92519064-92519086 CTTGGGGACAGTGGCTCAGATGG - Intronic
1060042048 9:120308394-120308416 CTAGGTGGCTTTTGATCTGAAGG - Intergenic
1060277123 9:122190884-122190906 GTAGGCTGCATTTGCACAGAGGG + Intronic
1203774726 EBV:66390-66412 CGAGGCGGCATCTGCTCAGCGGG - Intergenic
1203532532 Un_GL000213v1:160238-160260 CTACTGGGTATTTGCTCAAAGGG + Intergenic
1193871046 X:86798994-86799016 CTTGGGAGAATTTGCTCAGTAGG - Intronic