ID: 1040017794

View in Genome Browser
Species Human (GRCh38)
Location 8:42713977-42713999
Sequence CTATATCCTCTGTAGTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040017794_1040017798 18 Left 1040017794 8:42713977-42713999 CCAGAAAACTACAGAGGATATAG 0: 1
1: 1
2: 1
3: 15
4: 189
Right 1040017798 8:42714018-42714040 GCACAGATTGAGTTTGGAGTGGG No data
1040017794_1040017797 17 Left 1040017794 8:42713977-42713999 CCAGAAAACTACAGAGGATATAG 0: 1
1: 1
2: 1
3: 15
4: 189
Right 1040017797 8:42714017-42714039 TGCACAGATTGAGTTTGGAGTGG No data
1040017794_1040017796 12 Left 1040017794 8:42713977-42713999 CCAGAAAACTACAGAGGATATAG 0: 1
1: 1
2: 1
3: 15
4: 189
Right 1040017796 8:42714012-42714034 CCATTTGCACAGATTGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040017794 Original CRISPR CTATATCCTCTGTAGTTTTC TGG (reversed) Intronic
902476605 1:16691825-16691847 CTTTCTCCTCTGTAATATTCAGG - Intergenic
905904122 1:41605516-41605538 CTATAAGCTTTGTATTTTTCAGG - Intronic
906284607 1:44578582-44578604 CTCTATCCCCTGAAGTGTTCTGG - Intronic
906937696 1:50228629-50228651 CTATATACTCTGAAGTTTTGAGG + Intergenic
909965257 1:81901805-81901827 CTATATCCCTTGAAGTTTTCAGG + Intronic
910345237 1:86228790-86228812 CAATATTCTTTGGAGTTTTCTGG + Intergenic
911823943 1:102456895-102456917 GAATATCCTATGTATTTTTCAGG - Intergenic
915962645 1:160279886-160279908 CTGGATCCTCTGTTGTTTTCTGG - Intronic
916129595 1:161600883-161600905 CCATATTGTCTGTGGTTTTCAGG - Intronic
916282307 1:163065283-163065305 CTCTATCCTCTGTGCTTTCCTGG + Intergenic
918671964 1:187228543-187228565 CTAAAGCCTCTATAGTTTCCTGG - Intergenic
919996693 1:202758438-202758460 CTATACCCTCCGTACTTTTGGGG - Exonic
923422481 1:233831622-233831644 ATATATCTTCTATTGTTTTCTGG + Intergenic
924838804 1:247685965-247685987 TTATGTCCTCTGTATTTCTCTGG + Intergenic
1064094637 10:12414397-12414419 CTTTTTCCTCTGTGGTTTTAGGG + Intronic
1064839876 10:19579639-19579661 TTATTTCCTCTGTAATTTTAGGG + Intronic
1065355503 10:24836489-24836511 ATATATGCTCTGTAGTTCTTGGG - Intergenic
1066138674 10:32480012-32480034 CTTTATCCTTTGTATTTTTGTGG + Intronic
1067194123 10:44100094-44100116 CTATTTCCTCTATTGATTTCAGG - Intergenic
1069516120 10:69078611-69078633 CTATATTGTCTTGAGTTTTCAGG + Intergenic
1070559781 10:77557533-77557555 ATATATCCTCTGTTCATTTCTGG - Intronic
1071102131 10:82050967-82050989 TTTTCTCGTCTGTAGTTTTCTGG + Intronic
1071820698 10:89277623-89277645 CTGTATTCTCTGTATTTTTTAGG - Intronic
1074544856 10:114394465-114394487 CTCTATCCTCTGTGTCTTTCTGG + Intronic
1074781923 10:116808327-116808349 CTAAATCCTCTGAAGTTTCCTGG - Intergenic
1078009087 11:7557029-7557051 CTTCATCCTCTGTATTCTTCTGG + Intronic
1079943546 11:26712781-26712803 GTATATCCTCTGTTGTGCTCTGG + Intronic
1080033898 11:27691094-27691116 CTTTATCCTCTCTGATTTTCAGG - Intronic
1080708923 11:34727143-34727165 CTATATCCTCAGCAACTTTCTGG + Intergenic
1081276396 11:41154817-41154839 TTTTACCCTCTGTTGTTTTCTGG - Intronic
1085008917 11:73121960-73121982 TTATATCCTAAGTACTTTTCAGG - Intronic
1085624678 11:78062938-78062960 CCATATCCTCTGTAAATTTGAGG - Intronic
1086301761 11:85433844-85433866 CTGTATATTCTGTAGTTTTGGGG - Intronic
1088654802 11:111989033-111989055 CTTTATCCCCTGTAAGTTTCTGG - Intronic
1091987990 12:4928784-4928806 CTAGATCTTCTGTAATATTCAGG - Intronic
1093588733 12:20873437-20873459 CTTTATTCTCTGTAGTTCCCAGG + Intronic
1095734913 12:45546311-45546333 CTCTGTCCTCTGTTGCTTTCTGG - Intergenic
1099912115 12:88846895-88846917 TTATATCCTCTGTAGTGTAAAGG - Intergenic
1100077070 12:90798234-90798256 TTATATCCTTTGTCCTTTTCAGG + Intergenic
1101046715 12:100814155-100814177 CTATATACTCTGTAGTTTCCAGG + Intronic
1103559290 12:121784209-121784231 CTATACTCTATGCAGTTTTCAGG + Intronic
1105738224 13:23294303-23294325 CTATATCCTCTTGAATTTTATGG - Intronic
1108946068 13:56025926-56025948 TTATATTCTCTTTAATTTTCTGG - Intergenic
1109913359 13:68946162-68946184 CTAAATCCTAAGTAATTTTCAGG + Intergenic
1110280379 13:73686479-73686501 TTATATACTCTGTAGTGTTTAGG - Exonic
1110388724 13:74945739-74945761 CTATATTCTCATTTGTTTTCTGG - Intergenic
1111371823 13:87329052-87329074 CTCTATCATCTGTAGTTCTCAGG - Intergenic
1111707651 13:91770522-91770544 CTAAATCCTCTGGAGTTTCCTGG - Intronic
1113211020 13:107981384-107981406 CTGCATCCACTGTAGTTCTCTGG + Intergenic
1113977983 13:114245758-114245780 CTGTATCCTCTGCAGTATTCGGG + Intronic
1114313464 14:21488947-21488969 CCATCTCCTCTGCTGTTTTCTGG + Intronic
1115900527 14:38142182-38142204 GCATCCCCTCTGTAGTTTTCTGG - Intergenic
1116923278 14:50604600-50604622 CTATATCCTTTATACTTTTAAGG + Intronic
1117139450 14:52773126-52773148 ATATATCCTCTCTAGTAGTCTGG + Exonic
1117403633 14:55380351-55380373 TTATATTCTCTGTGGTCTTCTGG + Intronic
1117456213 14:55899253-55899275 CTCTTCCCTCTGTAGATTTCTGG - Intergenic
1121254686 14:92522644-92522666 CTAGATCCACAGAAGTTTTCAGG - Intronic
1125776285 15:42217678-42217700 CTATATAAACTATAGTTTTCAGG + Intronic
1126815846 15:52452478-52452500 CTATATCCTCTCTTTGTTTCTGG - Intronic
1127451785 15:59123759-59123781 CTTTATCCTTTATATTTTTCTGG + Intronic
1128917373 15:71576027-71576049 TTATGTCCTCTGCAGTTTTTTGG + Intronic
1129577659 15:76768757-76768779 CTATATCCTTGCTAGTTTTTTGG - Intronic
1130645440 15:85721976-85721998 CTCTTTTCTCTGCAGTTTTCAGG + Exonic
1130858765 15:87866998-87867020 TAATTTCCTCTGTTGTTTTCTGG - Intronic
1132154412 15:99485617-99485639 CTGTCTCCTCTGTATTTTACAGG + Intergenic
1138904402 16:61313345-61313367 CTTTATCCTGTCTAGTTTTTAGG - Intergenic
1140593880 16:76385415-76385437 ATATTTTCTCTGTATTTTTCAGG - Intronic
1140616231 16:76667867-76667889 CTGTATTCTCTGTAGTAGTCGGG + Intergenic
1142730429 17:1851091-1851113 CACTATCCTCTGTAATTTTGAGG + Intronic
1144026365 17:11279478-11279500 CCATTTCCTCCATAGTTTTCAGG + Intronic
1144659936 17:17061456-17061478 ATATATCCTCTGTAGTTTTCAGG - Intronic
1145375070 17:22339460-22339482 CTATATATTCTGTTGTTTGCTGG - Intergenic
1147998323 17:44373749-44373771 CTATATCCTCTGAATCTTTTTGG + Intronic
1155444195 18:25893697-25893719 ATTTATTCTCTGTAGTTTTGGGG - Intergenic
1156117122 18:33798759-33798781 ATATATCCTCTGTGGTTTTGGGG + Intergenic
1156410867 18:36827671-36827693 CTTTCTCCTCCTTAGTTTTCTGG + Intronic
1156805076 18:41168534-41168556 CTATAACCTCTTTGTTTTTCTGG - Intergenic
1157074845 18:44454227-44454249 CTAAAACCTTTGTAATTTTCTGG + Intergenic
1158156830 18:54435451-54435473 CTATCTCCTCTGCAGTTATCTGG + Intergenic
1158369894 18:56788612-56788634 CTATCTCCTTTGTGGTATTCTGG + Intronic
1159110732 18:64053583-64053605 CTATATCTGAAGTAGTTTTCTGG - Intergenic
1159414531 18:68126875-68126897 TTATAACCTATGTATTTTTCAGG + Intergenic
1164262896 19:23583834-23583856 CTTTATTCTCTGTAATTTTAGGG + Intronic
1166145267 19:40830207-40830229 CTATATCCACTGTATCTGTCAGG + Intronic
1202710626 1_KI270714v1_random:17666-17688 CTTTCTCCTCTGTAATATTCAGG - Intergenic
925862810 2:8196710-8196732 CTTTATTCTCTGTAGTTTCTTGG - Intergenic
926033574 2:9615151-9615173 CTATATTGTCTGGAGTTTACCGG - Intronic
929024942 2:37591392-37591414 ATATTTCCTCTATGGTTTTCTGG - Intergenic
929386886 2:41419041-41419063 TTATGTCCTCTTTATTTTTCAGG - Intergenic
933312491 2:80678009-80678031 ATTTATTCTCTGTGGTTTTCAGG + Intergenic
935316955 2:101844387-101844409 GAATATCCTCTGTAGCTTCCTGG + Intronic
941266372 2:163367700-163367722 TGTTATCCTCTGTAGTTTTTAGG - Intergenic
941705236 2:168651355-168651377 CTGTATCCTCTGTAGCCTTTGGG + Intronic
941718214 2:168786144-168786166 CTCTCTCCTCTGAACTTTTCTGG - Intergenic
944882120 2:204023987-204024009 CTAAAGTCTCTTTAGTTTTCTGG + Intergenic
946616934 2:221519948-221519970 TTATTTCCTCTGTAGTTTCTCGG + Intronic
948281205 2:236749139-236749161 CTATTTCCACTAAAGTTTTCAGG - Intergenic
1168902916 20:1380213-1380235 CTATATCCTTGGGAGTTTCCAGG + Intronic
1169697314 20:8404964-8404986 CTATTTCCTCTGATATTTTCAGG + Intronic
1171325805 20:24291464-24291486 CTCTTTCCTCTGTAGTTATGTGG + Intergenic
1172428909 20:34874574-34874596 CTATATCCTCTGTATCTCTTAGG + Intronic
1172993941 20:39056137-39056159 CTATATCTGCTGTAGTGTCCTGG - Intergenic
1175740506 20:61416784-61416806 CTATGTCCTCTGTCCCTTTCTGG - Intronic
1176263146 20:64193805-64193827 CTATAACCTATGTAATTTTATGG + Intronic
1179074414 21:38106307-38106329 CTATATCTTATGTAGTCTACAGG + Intronic
1179318064 21:40263158-40263180 CTTTATTGTCTTTAGTTTTCTGG - Intronic
1183123013 22:35745848-35745870 CTAGATCTTCTGTAGTCTACGGG + Intronic
1184230406 22:43155593-43155615 CTCTCTTCTCTGGAGTTTTCAGG + Intronic
1184938680 22:47744312-47744334 CTGTATCCTCTGCAGTTGTTAGG - Intergenic
1185387860 22:50544601-50544623 CTCCATCCTCTGAAGGTTTCTGG + Intergenic
950775154 3:15343158-15343180 TTATTTCCTCTATAGTTGTCAGG - Intergenic
951218802 3:20048237-20048259 CTGTATCCTCAGAAATTTTCAGG + Intronic
951416370 3:22427799-22427821 TTTTATCCTCTTTAGTTTTCTGG - Intergenic
955197313 3:56817073-56817095 CACTGTGCTCTGTAGTTTTCTGG - Intronic
955859213 3:63309843-63309865 CTAGAACCCCTGTAGTTTGCAGG - Intronic
955868022 3:63406224-63406246 CTATGCCCTGTATAGTTTTCAGG + Intronic
956043523 3:65171301-65171323 CTATATCCTTTAAAGTTTTCAGG - Intergenic
958071415 3:88618391-88618413 CTATATTCTCTACATTTTTCTGG + Intergenic
958178634 3:90028729-90028751 GTATATATTCTGCAGTTTTCAGG + Intergenic
960217088 3:115053816-115053838 CTTTTTCCTCTTTATTTTTCTGG - Intronic
960407652 3:117281756-117281778 CATTATACTCTGTAGTTTTTGGG + Intergenic
962289828 3:134124607-134124629 TGATGTCTTCTGTAGTTTTCTGG - Intronic
963037312 3:141043176-141043198 TTATTTTCTCTGTATTTTTCTGG - Intergenic
963823890 3:149930593-149930615 ATATACCCTCTGCTGTTTTCTGG + Intronic
964379801 3:156086887-156086909 CTAAATCCTGTGGGGTTTTCAGG - Intronic
965227588 3:166009639-166009661 CAATATCCTTTGTTGTTTCCAGG + Intergenic
965425419 3:168516879-168516901 GAATATCCTCTATGGTTTTCTGG - Intergenic
966306268 3:178538747-178538769 ATATCTCCTCTATATTTTTCAGG - Intronic
968498913 4:935614-935636 CTATATCCTCAGTGATTTTCTGG - Intronic
968824290 4:2882082-2882104 ATATATGTTCTGTAGTTTTCAGG + Intronic
971284837 4:25278914-25278936 CTATCTCAACTGTACTTTTCTGG - Exonic
971525300 4:27609635-27609657 TTAAATTCTCTGTAGTTGTCAGG + Intergenic
972116723 4:35644987-35645009 ATATATCCTATGTCATTTTCAGG + Intergenic
972379749 4:38508349-38508371 CTTTATGCTCTGTAGTTAACTGG - Intergenic
974711788 4:65607019-65607041 CTATATTTTATGTAGTTTTGAGG - Intronic
976428895 4:84939266-84939288 TCATCTCCTCTGTAGTATTCTGG - Intronic
977309675 4:95369974-95369996 CTATATCCTGTGTATTCTTGTGG - Intronic
979446415 4:120818411-120818433 CTTTCTCCTCTGTGGGTTTCTGG + Exonic
980739891 4:136936336-136936358 CTATATCCTGGGAAGTTTCCTGG - Intergenic
981170606 4:141618761-141618783 CTGAATGCTCTGTAGGTTTCTGG + Intergenic
981339819 4:143608457-143608479 CTCTAGCTTTTGTAGTTTTCAGG + Intronic
984899778 4:184575378-184575400 CTTTATCCTCTCTACTTTTTAGG - Intergenic
986620617 5:9669438-9669460 CTATATATTCTGTTGTTTTGGGG - Intronic
987943777 5:24577141-24577163 CTAAATGCACTGTAGTTTTCTGG + Intronic
988336226 5:29912250-29912272 GTATGTCCTCTGTAATTTTTAGG - Intergenic
989398438 5:40983358-40983380 CCATATCCTCTGTATTATTTAGG - Intergenic
993788943 5:92182739-92182761 CTATATTATCTCTCGTTTTCTGG - Intergenic
996061262 5:119036023-119036045 TTATAGCTTCTGTAGGTTTCTGG - Intergenic
998636880 5:143965318-143965340 CTATATTTTTTGTGGTTTTCTGG - Intergenic
1000489420 5:161891732-161891754 CTATTTCAACTGTATTTTTCAGG + Intronic
1003883773 6:10502317-10502339 CTATATCCTTCGTGGTTTTGTGG + Intronic
1004586409 6:17005795-17005817 ATAAATGTTCTGTAGTTTTCAGG + Intergenic
1005437506 6:25830811-25830833 GTTTGTTCTCTGTAGTTTTCAGG - Intronic
1007238889 6:40411098-40411120 TTATCTCATCTGTAATTTTCTGG + Intronic
1008056870 6:46954734-46954756 CTTTCTCTTCTGGAGTTTTCAGG + Intronic
1008082102 6:47205343-47205365 CTATCTCCTTTCTTGTTTTCAGG - Intergenic
1012710650 6:102599390-102599412 CTATGTAGTTTGTAGTTTTCAGG + Intergenic
1012814464 6:104004491-104004513 ACATTTCCTTTGTAGTTTTCAGG + Intergenic
1014709957 6:124795330-124795352 CTCTTTCCTCTGAAGTTTCCTGG - Intronic
1016075546 6:139791048-139791070 CTGTTTCCTCTTTTGTTTTCTGG + Intergenic
1016697197 6:147009963-147009985 CTATGTCCTCTGTTTTCTTCTGG - Intergenic
1017092516 6:150772819-150772841 TGATTTCCTCTGCAGTTTTCTGG + Intronic
1020407437 7:7853488-7853510 TATTATCCTTTGTAGTTTTCAGG + Intronic
1021501575 7:21337486-21337508 CTAATTACTCTGTAGGTTTCTGG + Intergenic
1021923744 7:25514499-25514521 CTATAACCTCTCTTTTTTTCTGG + Intergenic
1022446094 7:30471894-30471916 GCACATGCTCTGTAGTTTTCTGG - Intronic
1023591835 7:41788807-41788829 CTATATCCTCTTTACTTTAGAGG + Intergenic
1024872286 7:53978436-53978458 AAATATACTTTGTAGTTTTCAGG + Intergenic
1028235825 7:88360782-88360804 CTAAATCCTGTGGAATTTTCTGG + Intergenic
1028368137 7:90058874-90058896 CTTTCTCTTCTGTAGGTTTCAGG + Intergenic
1030579877 7:111341647-111341669 CTCTATCCTCTGTGGTTTCAAGG - Intronic
1030691933 7:112544914-112544936 CTATATATTCTGTTGTTTTTGGG + Intergenic
1031463636 7:122081793-122081815 CTATATCCTCAATACTTTTTTGG - Intronic
1031778558 7:125933670-125933692 CTATTTTCTCTGTAGTTTGTGGG - Intergenic
1033670043 7:143483291-143483313 CTATATCCTCTGTATCCTTACGG + Intergenic
1034624186 7:152479859-152479881 CTGTCTCCTTTGTAGCTTTCAGG + Intergenic
1037538188 8:19847081-19847103 CTGTAACCTCAGTAGTTTGCTGG + Intronic
1039237590 8:35519202-35519224 CTATATCTTGTTTAGTTTTTAGG + Intronic
1040017794 8:42713977-42713999 CTATATCCTCTGTAGTTTTCTGG - Intronic
1041090079 8:54293773-54293795 CAATATTTTCTGTAGTTTTATGG + Intergenic
1043288504 8:78566427-78566449 CTATATGTTCTGTAGCTTTTAGG + Intronic
1049528966 8:143143923-143143945 CTGTTTCTTCTGTAGTTTGCTGG - Intergenic
1050136073 9:2466024-2466046 TAATATCCTCTGTACTGTTCTGG + Intergenic
1050239307 9:3617783-3617805 GTATATTCTCTGTTGTTTTGAGG + Intergenic
1051184696 9:14447621-14447643 ATATTTTCTTTGTAGTTTTCTGG + Intergenic
1052490697 9:29163187-29163209 CTACATCCTCAGCAGTTTTCTGG - Intergenic
1056377044 9:86024863-86024885 CTATAGTCACTGTAATTTTCTGG + Intergenic
1058019545 9:100072813-100072835 CTCTATCTTCTGGAGTTTTGAGG + Intronic
1058738100 9:107915185-107915207 CTATATCCAATGTATTTGTCAGG + Intergenic
1060968469 9:127724611-127724633 CTCCGTCCTCTCTAGTTTTCTGG - Intronic
1188386572 X:29567273-29567295 TTTTATCCTCAGTTGTTTTCTGG - Intronic
1188576001 X:31650957-31650979 CTTCATCCTTTGTAGATTTCTGG - Intronic
1188923409 X:36008286-36008308 ATAAGTCCTCTGTATTTTTCTGG + Intergenic
1190435871 X:50424593-50424615 AGATATCCTCTGTGGTTTTTGGG - Intronic
1192005309 X:67205542-67205564 CTATATATTGTGTAGTTTTGAGG + Intergenic
1195473257 X:105257401-105257423 ATATATATTCTGTTGTTTTCAGG + Intronic
1195788305 X:108552599-108552621 CAATATTTTTTGTAGTTTTCAGG - Intronic
1196690970 X:118557824-118557846 CCAAATCCTGTGCAGTTTTCTGG + Intronic
1196802038 X:119552454-119552476 TGATATCCTCTGTAGTTAACTGG - Intronic
1197371453 X:125630986-125631008 ATATATATTCTGTAGTTTTGGGG - Intergenic
1198415636 X:136417102-136417124 CTACTTCCTCTGTGGGTTTCAGG - Intergenic
1199011272 X:142761680-142761702 CTTTGTACTCTGTTGTTTTCAGG - Intergenic
1199315209 X:146368777-146368799 CTGTATACTCTGTATTTCTCAGG - Intergenic
1201666617 Y:16464141-16464163 CTTTTTCCTCTGTAGGTTGCAGG - Intergenic
1201933884 Y:19385371-19385393 CTATTTTCTCTGTATCTTTCCGG + Intergenic
1202335295 Y:23802484-23802506 CTATATCTTCTTTACTATTCTGG - Intergenic
1202535472 Y:25867575-25867597 CTATATCTTCTTTACTATTCTGG + Intergenic