ID: 1040017796

View in Genome Browser
Species Human (GRCh38)
Location 8:42714012-42714034
Sequence CCATTTGCACAGATTGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040017794_1040017796 12 Left 1040017794 8:42713977-42713999 CCAGAAAACTACAGAGGATATAG 0: 1
1: 1
2: 1
3: 15
4: 189
Right 1040017796 8:42714012-42714034 CCATTTGCACAGATTGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040017796 Original CRISPR CCATTTGCACAGATTGAGTT TGG Intronic
No off target data available for this crispr