ID: 1040024206

View in Genome Browser
Species Human (GRCh38)
Location 8:42766742-42766764
Sequence GGTCCAGGGAAGAAGAGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040024198_1040024206 1 Left 1040024198 8:42766718-42766740 CCACACACTAGAGCCTCTTGAGG 0: 1
1: 0
2: 0
3: 23
4: 435
Right 1040024206 8:42766742-42766764 GGTCCAGGGAAGAAGAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040024206 Original CRISPR GGTCCAGGGAAGAAGAGCAT TGG Intronic
No off target data available for this crispr