ID: 1040030984

View in Genome Browser
Species Human (GRCh38)
Location 8:42823422-42823444
Sequence GACAGCTCTTGACCTGCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040030984_1040030988 16 Left 1040030984 8:42823422-42823444 CCATTAGCAGGTCAAGAGCTGTC No data
Right 1040030988 8:42823461-42823483 TTTATCTGTGGATGATGGCAGGG No data
1040030984_1040030985 4 Left 1040030984 8:42823422-42823444 CCATTAGCAGGTCAAGAGCTGTC No data
Right 1040030985 8:42823449-42823471 AAAACGAGAGTATTTATCTGTGG No data
1040030984_1040030987 15 Left 1040030984 8:42823422-42823444 CCATTAGCAGGTCAAGAGCTGTC No data
Right 1040030987 8:42823460-42823482 ATTTATCTGTGGATGATGGCAGG No data
1040030984_1040030986 11 Left 1040030984 8:42823422-42823444 CCATTAGCAGGTCAAGAGCTGTC No data
Right 1040030986 8:42823456-42823478 GAGTATTTATCTGTGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040030984 Original CRISPR GACAGCTCTTGACCTGCTAA TGG (reversed) Intergenic
No off target data available for this crispr