ID: 1040030987

View in Genome Browser
Species Human (GRCh38)
Location 8:42823460-42823482
Sequence ATTTATCTGTGGATGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040030983_1040030987 16 Left 1040030983 8:42823421-42823443 CCCATTAGCAGGTCAAGAGCTGT No data
Right 1040030987 8:42823460-42823482 ATTTATCTGTGGATGATGGCAGG No data
1040030984_1040030987 15 Left 1040030984 8:42823422-42823444 CCATTAGCAGGTCAAGAGCTGTC No data
Right 1040030987 8:42823460-42823482 ATTTATCTGTGGATGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040030987 Original CRISPR ATTTATCTGTGGATGATGGC AGG Intergenic
No off target data available for this crispr