ID: 1040032962

View in Genome Browser
Species Human (GRCh38)
Location 8:42842921-42842943
Sequence GCGCGTGTCCGCGCGAGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040032962_1040032969 2 Left 1040032962 8:42842921-42842943 CCGCCCCTCGCGCGGACACGCGC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1040032969 8:42842946-42842968 GGCTCCGCCCCCGGCCCCGCCGG 0: 2
1: 2
2: 7
3: 79
4: 663
1040032962_1040032979 21 Left 1040032962 8:42842921-42842943 CCGCCCCTCGCGCGGACACGCGC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1040032979 8:42842965-42842987 CCGGCCGCGCGCCCCCACCCCGG 0: 1
1: 1
2: 8
3: 64
4: 404
1040032962_1040032967 -7 Left 1040032962 8:42842921-42842943 CCGCCCCTCGCGCGGACACGCGC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1040032967 8:42842937-42842959 CACGCGCCTGGCTCCGCCCCCGG 0: 1
1: 2
2: 1
3: 19
4: 826

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040032962 Original CRISPR GCGCGTGTCCGCGCGAGGGG CGG (reversed) Intronic
901019625 1:6249239-6249261 GCGCATGTCTGCGCGCGGGGCGG + Exonic
901660686 1:10796254-10796276 GCGCGGCTCCGGGGGAGGGGAGG - Intronic
903190113 1:21651715-21651737 GTGCGTGTGCACGCGTGGGGGGG - Intronic
903555032 1:24187162-24187184 GCGCGGGGCCGCGGGAGGGAGGG - Intronic
904525291 1:31128907-31128929 GCGAGTGTCCCAGTGAGGGGAGG + Intergenic
904541935 1:31239367-31239389 GCGTGTGCCCGGGCGGGGGGTGG - Intronic
904643019 1:31944716-31944738 GCGTGGGTCCGCGCGCGGAGGGG + Intronic
904837777 1:33349966-33349988 GGGCGGGGCCGCGGGAGGGGCGG + Intronic
908131973 1:61082972-61082994 GCGCGTGTGCCCGCGGGTGGGGG + Intronic
908131975 1:61082974-61082996 GCGTGTGCCCGCGGGTGGGGGGG + Intronic
910257184 1:85259704-85259726 GGGCGGGGCCACGCGAGGGGCGG - Intergenic
912717109 1:111990355-111990377 GCGCGTGTGCCAGCGAGGGTGGG + Intergenic
914393469 1:147242667-147242689 GCGCTTGGCCGCGCGGGGCGGGG + Exonic
916535378 1:165698605-165698627 GGGCGGGGCCGCGGGAGGGGCGG + Exonic
1062874158 10:931730-931752 GCGCGGGTCCGCGCGGGGGCGGG - Intergenic
1063114796 10:3066489-3066511 GCGCGTGTCCGTGGGGAGGGAGG + Intronic
1064981947 10:21174137-21174159 GAGCGAGTGAGCGCGAGGGGCGG - Intronic
1067024983 10:42836928-42836950 GCGCGGGTCCGAGGGAGGTGGGG - Intergenic
1068455571 10:57250114-57250136 GCCCGTGGCCGGGGGAGGGGAGG - Intergenic
1069893677 10:71667396-71667418 GCGCGTGTGTGTGTGAGGGGTGG + Intronic
1073111649 10:101066362-101066384 GTGCGTAGCCGCGGGAGGGGCGG - Intronic
1073250968 10:102120154-102120176 CGGCCTGTCCCCGCGAGGGGCGG - Exonic
1076369970 10:129946186-129946208 GGGCGGGTCCGCGCGAGGCCAGG - Intronic
1076373937 10:129971456-129971478 GCGCGTGTGCGGGCGAGGGTCGG - Intergenic
1077201508 11:1309691-1309713 GCGCGCGTGCGCGCGAGAGCCGG - Intergenic
1081994713 11:47355776-47355798 GCGAGTGTGTGCGCGTGGGGGGG - Intronic
1083437558 11:62653124-62653146 GCGCGGGGCCGCGCGATGGGGGG + Intronic
1083753636 11:64777867-64777889 GCGCGCGTGCGCGCACGGGGAGG - Intronic
1084935486 11:72584483-72584505 GGGCGGGTCCGAGCGAGCGGGGG - Intronic
1089729439 11:120511468-120511490 GCGCGGGTCCGCGCGGCCGGGGG - Intergenic
1092184842 12:6471039-6471061 GCGCGAGTCCCGGCGCGGGGTGG - Intergenic
1096127701 12:49131550-49131572 CCCCGCGGCCGCGCGAGGGGAGG - Intergenic
1096994614 12:55830808-55830830 GCGCGCGTGCGCGCGGTGGGGGG - Intronic
1102101460 12:110281583-110281605 GCTCGGGGCCGCGCGAGGGGCGG + Intronic
1108518163 13:51222203-51222225 GCGCGTGTGCGAGCGCGTGGGGG - Intergenic
1112216265 13:97434136-97434158 GGGCGTGGAGGCGCGAGGGGCGG + Intergenic
1113473261 13:110561685-110561707 GCGCGTGTGCGCGCCCGGGAAGG + Exonic
1117875775 14:60249206-60249228 GCGCGGGGCCGCGCTAGAGGCGG + Intronic
1121101557 14:91253532-91253554 GCGCGTGCGCGTGCGAGGCGGGG - Intronic
1121417402 14:93788723-93788745 GCGCCTAGCCGCGCGCGGGGCGG + Intergenic
1124696894 15:31870818-31870840 GCGCACGTCCGCGCGGGGCGGGG - Intergenic
1126150893 15:45522796-45522818 GCGCGTGGCCTCGCGCAGGGCGG - Exonic
1129710818 15:77819565-77819587 GCGCGTGTGTGCGCGAGTGTGGG - Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1130390199 15:83447891-83447913 GCCCCTACCCGCGCGAGGGGAGG + Intronic
1131386667 15:92013986-92014008 GGGAGTGACCACGCGAGGGGAGG - Intronic
1140122280 16:72093972-72093994 GAGCCTGTCTGAGCGAGGGGTGG + Exonic
1143554372 17:7651484-7651506 GGGCGAGTCCGGGCGCGGGGCGG - Exonic
1152107993 17:78341968-78341990 GGGCGGGTCCGCGGGCGGGGTGG + Intergenic
1160453066 18:78978906-78978928 GCGCCTGTGCGCGCGGGGCGAGG + Intergenic
1160499806 18:79396062-79396084 GGGCGTGTGCGCGCGTGGCGGGG - Intronic
1163845943 19:19638090-19638112 GCGCGTGTGGGCGAGAGTGGAGG + Intronic
1166694858 19:44846634-44846656 GAGGGGGTCCGCGCGAGGGCAGG - Intronic
1168336527 19:55600362-55600384 GCGAGTGTGCGCGCGCGCGGGGG - Intronic
929313575 2:40452175-40452197 GCGAGTGTGCGCGGGAGGGAGGG - Intronic
935971498 2:108534404-108534426 GCGCGGGGGCGCGGGAGGGGGGG - Intronic
940316959 2:152335998-152336020 GCGCGTGTGCCCGGGAGGTGCGG + Intronic
945699439 2:213151849-213151871 GCGCGTGTGCGCGCGCGCGCGGG + Intronic
948751530 2:240136127-240136149 GCGCGGGTCCCGGGGAGGGGAGG - Intronic
1168946736 20:1767201-1767223 GAGCGTGTCCGCGATGGGGGTGG + Intergenic
1174504662 20:51009534-51009556 GCGCGTTTCCCCGCGGGGCGTGG + Intronic
1178922419 21:36747562-36747584 GCGCGTGGGCGGCCGAGGGGTGG + Intronic
1182149506 22:28018289-28018311 GCGCGTGTGTGCGCGCGCGGGGG + Intronic
1182149508 22:28018291-28018313 GCGTGTGTGCGCGCGCGGGGGGG + Intronic
1184060779 22:42079736-42079758 GCGGGTGCCCGGGTGAGGGGCGG + Exonic
1184236435 22:43185724-43185746 GCGAGTGACCGCCCGAGGGAGGG + Intronic
950119951 3:10475105-10475127 GCGGGCGTCAGCACGAGGGGTGG + Intronic
950650199 3:14402500-14402522 GCGTGTGTCCGCACTTGGGGCGG + Intergenic
951411592 3:22372805-22372827 GTGCGAGCCCGCGCGAAGGGAGG + Intronic
956681448 3:71785252-71785274 GCGCGTGTGCGCGTGGGGCGTGG - Intergenic
960101335 3:113746253-113746275 GCGCGCCGGCGCGCGAGGGGCGG - Exonic
968272802 3:197417562-197417584 GCGTGTGTCGGGGCAAGGGGAGG + Intergenic
968434172 4:576365-576387 GCGCGGGGCCGCGGGCGGGGTGG - Intergenic
970407668 4:15778844-15778866 GAGCGTGCCCGCGGGAGGCGGGG + Intronic
971019058 4:22516071-22516093 GCGCGGGTCCTGGCCAGGGGAGG - Intergenic
985565851 5:616824-616846 GTGTGTGTGCGCGCGAGTGGGGG + Intronic
993140055 5:84020606-84020628 GTGTGTGTCGGCGGGAGGGGTGG - Intronic
996184958 5:120464206-120464228 GCGCGTGTGCGCGAGAGCGCCGG + Intergenic
1002699818 5:181114864-181114886 GCGAGTGGCGGAGCGAGGGGCGG + Intergenic
1007644510 6:43369674-43369696 GCGCGAGGCTGGGCGAGGGGAGG + Intergenic
1012399523 6:98832711-98832733 GCGCGGGTGCGCGCGTGGTGGGG + Intergenic
1012410127 6:98947643-98947665 GCGCGGGGCCGCGGGCGGGGAGG + Intronic
1013225396 6:108117006-108117028 TCGCGTGGCCGCGGGAGTGGAGG - Intronic
1013507567 6:110815234-110815256 GCGCGCGCGCGCGCGAGAGGCGG - Exonic
1023722675 7:43112701-43112723 GCGAGTGTGTGCGCGAGGAGGGG - Exonic
1024579936 7:50793290-50793312 GCGCGGGTCCCCGCGGGGCGAGG + Intronic
1033165612 7:139036143-139036165 GCGGGAGGCCGGGCGAGGGGCGG + Intergenic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1034898367 7:154892104-154892126 GTGCATGTCCACGCTAGGGGAGG + Intronic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1039212698 8:35235365-35235387 GGGCGGGGCCGCGGGAGGGGCGG - Intergenic
1040032962 8:42842921-42842943 GCGCGTGTCCGCGCGAGGGGCGG - Intronic
1046521361 8:115330646-115330668 GCGGGAGTCCACGGGAGGGGTGG + Intergenic
1047969533 8:130072817-130072839 GTGTGTGTGCGCGCGGGGGGGGG + Intronic
1057245601 9:93451874-93451896 GCGCGGGTGCGGGCGGGGGGCGG - Exonic
1058176051 9:101737779-101737801 GCGGCTGGCCGCGCGGGGGGCGG + Exonic
1185505635 X:630833-630855 GCGCGTCTCCCCGCGCGGAGAGG - Exonic
1191830119 X:65407227-65407249 GGGCGAGTGCGCGCGAGGCGCGG + Intronic
1195294904 X:103466416-103466438 GCCCGAGTCAGCGTGAGGGGTGG + Intergenic
1200068878 X:153518118-153518140 GCGCGTGCGCGCGCGATGCGGGG - Intronic