ID: 1040032969

View in Genome Browser
Species Human (GRCh38)
Location 8:42842946-42842968
Sequence GGCTCCGCCCCCGGCCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 753
Summary {0: 2, 1: 2, 2: 7, 3: 79, 4: 663}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040032962_1040032969 2 Left 1040032962 8:42842921-42842943 CCGCCCCTCGCGCGGACACGCGC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1040032969 8:42842946-42842968 GGCTCCGCCCCCGGCCCCGCCGG 0: 2
1: 2
2: 7
3: 79
4: 663
1040032952_1040032969 28 Left 1040032952 8:42842895-42842917 CCGACACGGCCGGCCCCAGACCC 0: 1
1: 0
2: 0
3: 15
4: 277
Right 1040032969 8:42842946-42842968 GGCTCCGCCCCCGGCCCCGCCGG 0: 2
1: 2
2: 7
3: 79
4: 663
1040032960_1040032969 6 Left 1040032960 8:42842917-42842939 CCACCCGCCCCTCGCGCGGACAC 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1040032969 8:42842946-42842968 GGCTCCGCCCCCGGCCCCGCCGG 0: 2
1: 2
2: 7
3: 79
4: 663
1040032966_1040032969 -3 Left 1040032966 8:42842926-42842948 CCTCGCGCGGACACGCGCCTGGC 0: 1
1: 0
2: 2
3: 4
4: 98
Right 1040032969 8:42842946-42842968 GGCTCCGCCCCCGGCCCCGCCGG 0: 2
1: 2
2: 7
3: 79
4: 663
1040032964_1040032969 -2 Left 1040032964 8:42842925-42842947 CCCTCGCGCGGACACGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1040032969 8:42842946-42842968 GGCTCCGCCCCCGGCCCCGCCGG 0: 2
1: 2
2: 7
3: 79
4: 663
1040032956_1040032969 13 Left 1040032956 8:42842910-42842932 CCAGACCCCACCCGCCCCTCGCG 0: 1
1: 0
2: 2
3: 35
4: 409
Right 1040032969 8:42842946-42842968 GGCTCCGCCCCCGGCCCCGCCGG 0: 2
1: 2
2: 7
3: 79
4: 663
1040032953_1040032969 19 Left 1040032953 8:42842904-42842926 CCGGCCCCAGACCCCACCCGCCC 0: 1
1: 0
2: 11
3: 168
4: 1499
Right 1040032969 8:42842946-42842968 GGCTCCGCCCCCGGCCCCGCCGG 0: 2
1: 2
2: 7
3: 79
4: 663
1040032959_1040032969 7 Left 1040032959 8:42842916-42842938 CCCACCCGCCCCTCGCGCGGACA 0: 1
1: 0
2: 1
3: 2
4: 82
Right 1040032969 8:42842946-42842968 GGCTCCGCCCCCGGCCCCGCCGG 0: 2
1: 2
2: 7
3: 79
4: 663
1040032963_1040032969 -1 Left 1040032963 8:42842924-42842946 CCCCTCGCGCGGACACGCGCCTG 0: 1
1: 0
2: 0
3: 5
4: 31
Right 1040032969 8:42842946-42842968 GGCTCCGCCCCCGGCCCCGCCGG 0: 2
1: 2
2: 7
3: 79
4: 663
1040032951_1040032969 29 Left 1040032951 8:42842894-42842916 CCCGACACGGCCGGCCCCAGACC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1040032969 8:42842946-42842968 GGCTCCGCCCCCGGCCCCGCCGG 0: 2
1: 2
2: 7
3: 79
4: 663
1040032954_1040032969 15 Left 1040032954 8:42842908-42842930 CCCCAGACCCCACCCGCCCCTCG 0: 1
1: 0
2: 3
3: 52
4: 510
Right 1040032969 8:42842946-42842968 GGCTCCGCCCCCGGCCCCGCCGG 0: 2
1: 2
2: 7
3: 79
4: 663
1040032958_1040032969 8 Left 1040032958 8:42842915-42842937 CCCCACCCGCCCCTCGCGCGGAC 0: 1
1: 0
2: 1
3: 17
4: 228
Right 1040032969 8:42842946-42842968 GGCTCCGCCCCCGGCCCCGCCGG 0: 2
1: 2
2: 7
3: 79
4: 663
1040032955_1040032969 14 Left 1040032955 8:42842909-42842931 CCCAGACCCCACCCGCCCCTCGC 0: 1
1: 0
2: 3
3: 27
4: 456
Right 1040032969 8:42842946-42842968 GGCTCCGCCCCCGGCCCCGCCGG 0: 2
1: 2
2: 7
3: 79
4: 663
1040032961_1040032969 3 Left 1040032961 8:42842920-42842942 CCCGCCCCTCGCGCGGACACGCG 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1040032969 8:42842946-42842968 GGCTCCGCCCCCGGCCCCGCCGG 0: 2
1: 2
2: 7
3: 79
4: 663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040032969 Original CRISPR GGCTCCGCCCCCGGCCCCGC CGG Intronic