ID: 1040034112

View in Genome Browser
Species Human (GRCh38)
Location 8:42851940-42851962
Sequence GCATTTAAATGGATGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040034107_1040034112 -4 Left 1040034107 8:42851921-42851943 CCACACTGTCCTCGCTTGAGCAT 0: 1
1: 0
2: 1
3: 11
4: 100
Right 1040034112 8:42851940-42851962 GCATTTAAATGGATGGATGGTGG No data
1040034105_1040034112 26 Left 1040034105 8:42851891-42851913 CCAAAGTGCTGGGATGATAGGTG 0: 46
1: 7147
2: 91327
3: 229869
4: 258088
Right 1040034112 8:42851940-42851962 GCATTTAAATGGATGGATGGTGG No data
1040034106_1040034112 -1 Left 1040034106 8:42851918-42851940 CCACCACACTGTCCTCGCTTGAG 0: 1
1: 0
2: 0
3: 15
4: 182
Right 1040034112 8:42851940-42851962 GCATTTAAATGGATGGATGGTGG No data
1040034104_1040034112 27 Left 1040034104 8:42851890-42851912 CCCAAAGTGCTGGGATGATAGGT 0: 51
1: 7650
2: 106854
3: 328273
4: 231945
Right 1040034112 8:42851940-42851962 GCATTTAAATGGATGGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040034112 Original CRISPR GCATTTAAATGGATGGATGG TGG Intronic
No off target data available for this crispr