ID: 1040038006

View in Genome Browser
Species Human (GRCh38)
Location 8:42889301-42889323
Sequence ACCTAATTCTATAGGTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 2, 2: 26, 3: 11, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040038001_1040038006 12 Left 1040038001 8:42889266-42889288 CCTTCCTACACTCTAAACTAGAG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1040038006 8:42889301-42889323 ACCTAATTCTATAGGTATGAGGG 0: 1
1: 2
2: 26
3: 11
4: 124
1040038002_1040038006 8 Left 1040038002 8:42889270-42889292 CCTACACTCTAAACTAGAGAAAA 0: 1
1: 0
2: 0
3: 21
4: 279
Right 1040038006 8:42889301-42889323 ACCTAATTCTATAGGTATGAGGG 0: 1
1: 2
2: 26
3: 11
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040038006 Original CRISPR ACCTAATTCTATAGGTATGA GGG Intronic
908330907 1:63070283-63070305 AGCATATTCTATAGTTATGATGG - Intergenic
911779990 1:101864561-101864583 ACAAAATTGTATAGGTTTGAGGG + Intronic
917746686 1:178016022-178016044 ACATAATTGTATAGTTTTGAGGG + Intergenic
921748999 1:218770793-218770815 AGGTAATTCTATGGGTATTATGG + Intergenic
924556122 1:245120126-245120148 ACAAAATTCAAAAGGTATGAAGG + Intronic
1062770957 10:100428-100450 ACACAATTCTACAGGTATCATGG - Intergenic
1063239146 10:4150556-4150578 TCCTAATTCTAGAGGTTTGAAGG - Intergenic
1066087272 10:31983274-31983296 ACCTAAACCTATAGGTAATAAGG - Intergenic
1068298209 10:55103590-55103612 AGCTATTTCTATAGCAATGATGG + Intronic
1069926439 10:71853782-71853804 ACATATTCCTCTAGGTATGAAGG - Intergenic
1071133978 10:82432068-82432090 ACCTCCCTCTATAGGAATGAAGG - Intronic
1073487945 10:103833259-103833281 AAGTGATTCCATAGGTATGAGGG + Intronic
1077831184 11:5872539-5872561 ATTTCATTATATAGGTATGATGG - Intronic
1079544357 11:21614696-21614718 ACCAATTTCTATAGCTGTGAGGG - Intergenic
1079896254 11:26122215-26122237 CCTTAACTCTATAGGTAAGATGG - Intergenic
1080114732 11:28609112-28609134 ACCCAAATCAATAGGTATGAGGG - Intergenic
1083007601 11:59362762-59362784 ACCTAATACTATAAGTCTGTTGG + Intergenic
1088547843 11:110979541-110979563 ATTTAATTCTGTAAGTATGAAGG - Intergenic
1092018099 12:5176364-5176386 ACCTAAGGATTTAGGTATGAGGG + Intergenic
1093962315 12:25287643-25287665 GCCTAATACTATAGGTCTCATGG - Intergenic
1094071682 12:26422593-26422615 ACAGAATTCTACAGCTATGAGGG - Intronic
1094236288 12:28170482-28170504 AAATAATTATATAGGTATGAGGG + Intronic
1097931294 12:65189888-65189910 ATCCAAATCTATAGGTATTACGG - Intronic
1099557818 12:84131688-84131710 AACTAATTTGAAAGGTATGATGG + Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1106255464 13:28018765-28018787 ACCTAATTCTGCAGCTATGGTGG + Intronic
1107001307 13:35548502-35548524 ACATAATGCTATGGGTATAAGGG + Intronic
1107359732 13:39604855-39604877 ATCATATTATATAGGTATGAAGG - Intergenic
1109174716 13:59141096-59141118 ACCTATTTCTAAAGGTGAGATGG - Intergenic
1111007595 13:82268523-82268545 TCCTAATTTTATAGTTATCAGGG + Intergenic
1111399038 13:87708111-87708133 GCCTAATTCTATAGGAAAAAGGG - Intergenic
1111573936 13:90125831-90125853 ACCATATTAAATAGGTATGAAGG - Intergenic
1117995540 14:61474386-61474408 ACCTTACTCTAAAGGTATGGAGG - Intronic
1119052979 14:71388916-71388938 ACCTATTTATATAGGTAAGGTGG - Intronic
1122424376 14:101597131-101597153 ACCTATTTCCATAGGTTTGGGGG + Intergenic
1128389509 15:67173606-67173628 ACTTTATTCTATAGGCAAGAGGG - Intronic
1136268557 16:29134742-29134764 ACCTTATTCTATAATGATGATGG + Intergenic
1140676067 16:77331262-77331284 ACCTAATTCAATAGCTCTGCTGG - Intronic
1142071868 16:88095113-88095135 ACCTTATTCTATAATGATGATGG + Intronic
1155070284 18:22308965-22308987 ACCAATTTCTACAGGAATGAAGG + Intergenic
1164480788 19:28609622-28609644 ACTTAATTCTATGAGTATGGGGG - Intergenic
1166631969 19:44414891-44414913 ACCTCATTCTATAGGCATGATGG + Intergenic
1166636212 19:44453749-44453771 ACCTCATTCTATAGGCATGATGG - Intergenic
1166637075 19:44459818-44459840 ACCTCATTCTATAGGCATGATGG - Intergenic
1202649089 1_KI270706v1_random:164722-164744 ACCTCCTTCTATAGGCATGATGG + Intergenic
927837308 2:26409559-26409581 ACCTAAAGCTATAAGTATAATGG - Intronic
929476279 2:42252831-42252853 ACATAATTCTATAAGGATTAGGG - Intronic
930503940 2:52258070-52258092 ACCTAACTCTACCTGTATGAAGG + Intergenic
936839490 2:116752770-116752792 ACCTAATTGAATTGGTTTGAGGG + Intergenic
936992140 2:118377459-118377481 ACCTAATTGTAGAGGTAAGTGGG - Intergenic
937237400 2:120438934-120438956 ACATAATTCTACAGGCCTGAAGG - Intergenic
937279763 2:120709703-120709725 CTCTAATTCAATAGGTCTGAGGG - Intergenic
937653073 2:124342314-124342336 ACCCAAATCTACAGGTATTATGG - Intronic
938541050 2:132283806-132283828 ACCTCATTCTATAGGCATGATGG - Intergenic
938541872 2:132289711-132289733 ATCTCATTCTATAGGCATCATGG - Intergenic
938679535 2:133675321-133675343 ACTCAATTCTATAGGCAAGAAGG + Intergenic
939013219 2:136871651-136871673 ACCTGATTCTGAAGGTATCATGG - Intronic
939453981 2:142409550-142409572 AACTAATTATATTGGTATAAAGG + Intergenic
940737445 2:157469379-157469401 ATCTAGTTCTAGAAGTATGAAGG + Intronic
941099424 2:161280519-161280541 ACCTCATTCTATAGGCATGATGG + Intergenic
942269427 2:174259095-174259117 ACCTAAAACTACAGGTAAGAGGG - Intergenic
944409957 2:199430328-199430350 ACTTTATACTATATGTATGATGG - Intronic
946573779 2:221052137-221052159 ACCTAACTCTTTAGGTATTTGGG + Intergenic
946589784 2:221232668-221232690 ACCTAACACTATAGTTATTAAGG - Intergenic
1169748766 20:8970066-8970088 ACATAATTCTGGAGGTAAGATGG + Intergenic
1171869959 20:30516811-30516833 ACCTCATTCTATAGGCATGATGG - Intergenic
1171870749 20:30522592-30522614 ACCTCATTCTATAGGCATCATGG - Intergenic
1175509911 20:59517024-59517046 ACATAAATGTATAGGTCTGAAGG - Intergenic
1176611654 21:8989566-8989588 ACCTCACTCTAGAGGCATGATGG + Intergenic
1176662793 21:9655433-9655455 ACCTAATTCTATGGTGATGAAGG - Intergenic
1176662810 21:9655586-9655608 ACCTAATTCTATGGTGGTGAAGG - Intergenic
1176662823 21:9655706-9655728 ACCTAATTCTATGGTGGTGAAGG - Intergenic
1180352725 22:11817484-11817506 ACCTCATTCTATAGGCATGATGG + Intergenic
1180385525 22:12174873-12174895 ACCTCATTCTATAGGCATGATGG - Intergenic
949730210 3:7102495-7102517 ACATCATACCATAGGTATGAGGG - Intronic
950395870 3:12733468-12733490 GCCTCATTTTATAGGAATGATGG - Intergenic
952510186 3:34045130-34045152 TCCTATTTCTAAAGGGATGAGGG - Intergenic
954499449 3:50997000-50997022 ACCTATTTCTATAGGACTGCTGG - Intronic
955527337 3:59834833-59834855 GCATAAGTCTATAGATATGAAGG + Intronic
956224804 3:66945664-66945686 AGCACATGCTATAGGTATGATGG + Intergenic
957678131 3:83396525-83396547 ATGTATTTCTATAGGTTTGAGGG - Intergenic
958509468 3:95027654-95027676 ACTTAGTTCTGTAGGTATGTGGG - Intergenic
959750435 3:109828265-109828287 CCCTAATTCTATAATTATGGTGG - Intergenic
964092830 3:152896111-152896133 ACCTAAGTTTTTAGGTAAGAAGG + Intergenic
964397876 3:156266252-156266274 ACATAGTTCTATAGTAATGAAGG - Intronic
967611932 3:191516822-191516844 CCCTATTTCTATAGGTCTGTGGG + Intergenic
970178896 4:13367052-13367074 ACCTAATTTTAGAGGTGTAAGGG - Intronic
970509689 4:16769133-16769155 GCCGAATTCCATAGGTGTGATGG - Intronic
970770535 4:19606970-19606992 ACATAATACAATAGGAATGATGG - Intergenic
972853992 4:43083519-43083541 ACCTAAATCTATAGGAATCCTGG - Intergenic
973375377 4:49282705-49282727 ACCTAATTCTATAGGCATGATGG - Intergenic
973376279 4:49288718-49288740 ACCTCATTCTATAGGCATGATGG - Intergenic
973377198 4:49294873-49294895 ACCTCATTCTATAGGCATGATGG - Intergenic
973378120 4:49301009-49301031 ACCTCATTCTATAGGCATGATGG - Intergenic
973379068 4:49307307-49307329 ACCTCATTCTATAGGCATGATGG - Intergenic
973380029 4:49314343-49314365 ACCTCATTCTATAGGCATGATGG + Intergenic
973380945 4:49320498-49320520 ACCTCATTCTATAGGCATGATGG + Intergenic
973382034 4:49327536-49327558 ACCTAATTCTATAGGCATGATGG + Intergenic
973385562 4:49512151-49512173 ACCTCATTCTATAGGCATGATGG + Intergenic
974849021 4:67383503-67383525 ATGTATTTCTATAGGTTTGACGG - Intergenic
975454620 4:74575545-74575567 ACCTTATTCTATCCGTATGCAGG - Intergenic
977188655 4:93972225-93972247 AGACAATTCTATAGGTATAAAGG + Intergenic
979618493 4:122771600-122771622 CCATAATTCTATAGTTAAGATGG - Intergenic
980668119 4:135966804-135966826 AACTATGTATATAGGTATGAGGG + Intergenic
982322760 4:154096825-154096847 TTGTAATTCTATAGGTAGGAGGG + Intergenic
983771433 4:171554517-171554539 AAATAATTCAATGGGTATGAAGG + Intergenic
985412502 4:189700343-189700365 ACCTAATTCTATGGTGGTGAAGG + Intergenic
985412520 4:189700496-189700518 ACCTAATTCTATGGTGGTGAAGG + Intergenic
985412551 4:189700799-189700821 ACCTAATTCTATGGTGGTGAAGG + Intergenic
990055312 5:51569718-51569740 ATTTAATTCTATAGGTATCTGGG + Intergenic
990546943 5:56832142-56832164 CCCAAATTCTCTAAGTATGAAGG - Intronic
990728370 5:58781671-58781693 ACCTAATTGTATAGGTACCAGGG - Intronic
990968209 5:61472397-61472419 ACCACTTCCTATAGGTATGATGG + Intronic
991627548 5:68619713-68619735 ACCTAATTTTATAGCTAAGATGG - Intergenic
993245987 5:85453684-85453706 ACTTAATTCTATAGAAATCAAGG - Intergenic
994758626 5:103826259-103826281 AACTAGTTCTATGGGTAGGAAGG - Intergenic
995549795 5:113269413-113269435 ACATTATTCTAGAGATATGAAGG - Intronic
1003046539 6:2738402-2738424 GCCTTATTCTATATGCATGAGGG + Intronic
1006852716 6:37110751-37110773 GCTTAGTGCTATAGGTATGACGG - Intergenic
1011338607 6:86287122-86287144 GTCTTTTTCTATAGGTATGAAGG + Intergenic
1015291718 6:131545184-131545206 TCGTAATTCCATAGGGATGAAGG + Intergenic
1016329028 6:142936503-142936525 TACTAATTCTACAGGTATGAAGG + Intronic
1019871602 7:3768965-3768987 ACCAAAATCTATAGGTGTGCCGG + Intronic
1021469723 7:20987561-20987583 ACCTAATTTTAGAGATATCATGG - Intergenic
1021664418 7:22961314-22961336 ATCTAATTTTATAGTTATAATGG - Exonic
1023973248 7:45007419-45007441 AAATGATTCTACAGGTATGAGGG + Intronic
1026518698 7:71095829-71095851 AGCCAATGCTAGAGGTATGAGGG - Intergenic
1027756473 7:82220227-82220249 ACTTAATTATGTAGGTCTGATGG + Intronic
1027824146 7:83089392-83089414 ACAGAGTTCTATAGGCATGAGGG - Intronic
1036694660 8:10966730-10966752 ACCCTATTCTAGAGGTCTGAGGG - Intronic
1040038006 8:42889301-42889323 ACCTAATTCTATAGGTATGAGGG + Intronic
1043961208 8:86420771-86420793 ATATAATTATATAGCTATGAAGG + Intronic
1045044008 8:98257152-98257174 CCCTAATTCTAAAGGAAGGAGGG - Intronic
1045365508 8:101472047-101472069 ACCTAATTCTGTAAGTATCTTGG - Intergenic
1050250508 9:3738992-3739014 ACCTTATTCTATAGACCTGATGG - Intergenic
1050868381 9:10533690-10533712 ACCCAATTATATAGATATCAGGG + Intronic
1055198946 9:73633180-73633202 ACATAATTTTATAGGCATGAAGG - Intergenic
1056017073 9:82401236-82401258 ACATTATTCTATTGGGATGAAGG + Intergenic
1058587908 9:106530398-106530420 AACTAATTCGATAGGTTTCAAGG + Intergenic
1060163833 9:121392127-121392149 ACCTCATTGTATAGGTTTGTAGG + Intergenic
1203699094 Un_GL000214v1:120941-120963 ACCTCATTCTATAGGCATGATGG - Intergenic
1203700048 Un_GL000214v1:127251-127273 ACCTCATTCTATAGGCATGATGG - Intergenic
1203700959 Un_GL000214v1:133235-133257 ACCTCATTCTATAGGCATGATGG - Intergenic
1203479790 Un_GL000224v1:1815-1837 ACCTCATTCTATAGGCATGATGG - Intergenic
1203480757 Un_GL000224v1:8111-8133 ACCTCATTCTATATGCATGATGG - Intergenic
1203481718 Un_GL000224v1:14441-14463 ACCTCATTCTATAGGCATGATGG - Intergenic
1203549178 Un_KI270743v1:153915-153937 ACCTCATTCTATAGGCATGATGG + Intergenic
1203550132 Un_KI270743v1:160229-160251 ACCTCATTCTATAGGCATGATGG + Intergenic
1203567750 Un_KI270744v1:105952-105974 ACCTCATTCTATAGGCATGATGG - Intergenic
1203568810 Un_KI270744v1:112937-112959 ACCTCATTCTATAGGCATGATGG - Intergenic
1203569392 Un_KI270744v1:117189-117211 ACCTCATTCTATAGGCATGATGG - Intergenic
1203570342 Un_KI270744v1:123470-123492 ACCTCATTCTATAGGCATGATGG - Intergenic
1203670040 Un_KI270755v1:2183-2205 ACCTAATTCTATGGTGGTGAAGG - Intergenic
1203670072 Un_KI270755v1:2486-2508 ACCTAATTCTATGGTGGTGAAGG - Intergenic
1203670090 Un_KI270755v1:2639-2661 ACCTAATTCTATGGTGGTGAAGG - Intergenic
1185644060 X:1604527-1604549 ACCCAATTCTATAGGCCTGGGGG - Intergenic
1186403419 X:9280368-9280390 CCCTTATTCTATAGGTATCTGGG + Intergenic
1187025015 X:15425897-15425919 ACCTATCCCTAAAGGTATGATGG - Exonic
1188857419 X:35213553-35213575 ACCTAACTCCATAGGTCTTAAGG - Intergenic
1190047734 X:47126152-47126174 ACGTATGTCTACAGGTATGAGGG + Intergenic
1192144024 X:68668865-68668887 ACCTAATTTCATAGATATTATGG - Intronic
1192797083 X:74432879-74432901 ACAAAATTCAAAAGGTATGATGG + Intronic
1201453821 Y:14146357-14146379 ACCGAATTCTAGAGGGAAGATGG - Intergenic
1201624005 Y:15993354-15993376 ACATAATTCTATAGGTCTATGGG - Intergenic