ID: 1040039843

View in Genome Browser
Species Human (GRCh38)
Location 8:42904797-42904819
Sequence AGCTTGGTACAGATCGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040039843 Original CRISPR AGCTTGGTACAGATCGAGTA GGG (reversed) Intronic
901743741 1:11359082-11359104 TGCTTGGAACAGATGGAGGAGGG - Intergenic
907825912 1:58016741-58016763 AGCTTATTACAGATGGAGAATGG - Intronic
910162398 1:84287870-84287892 AGCGGGGTACAAATAGAGTATGG - Intergenic
911482670 1:98463738-98463760 AGCCTGTTACAGGTCTAGTAAGG + Intergenic
917156367 1:172003929-172003951 AGCTTGGTGCAGATGCACTATGG - Intronic
919020700 1:192101409-192101431 AGCTTGGCACAGAAGGAGGAGGG - Intergenic
1066347500 10:34603049-34603071 AGTTTGGTAGAGAGCGATTAAGG + Intronic
1067917725 10:50418540-50418562 AGCTTGGTATAAATCAAGAAAGG - Intronic
1078746015 11:14114918-14114940 AGCTTGGTAAAGAGAGAGTTTGG - Intronic
1079945049 11:26731819-26731841 AAATTGGTACTGATAGAGTAGGG + Intergenic
1081401667 11:42650086-42650108 AGCTTGGTACAGCTGAAGTGTGG + Intergenic
1085265541 11:75235961-75235983 AGCAAGGTACAGATGTAGTAAGG + Intergenic
1090131359 11:124145614-124145636 AGCTTGGTACTGAGACAGTAAGG - Intronic
1099782315 12:87212346-87212368 AGCTGGATACAGATGGAGTAGGG - Intergenic
1103297375 12:119899408-119899430 AGCTTTGTACAACTCTAGTAGGG - Intergenic
1121509814 14:94504051-94504073 AGCTTGCTTCAGATCGAGGGAGG - Intronic
1130437741 15:83918910-83918932 ACCATGGTAGAGATGGAGTATGG + Intronic
1133149913 16:3820299-3820321 AACTTGGTAAATATAGAGTAAGG + Intronic
1140531514 16:75670826-75670848 AGAAGGGTACAGATTGAGTAAGG - Intronic
1140908076 16:79427269-79427291 AGCCTGGTTCAGATCGCTTAGGG + Intergenic
933250545 2:80024411-80024433 AGCTAGGTAGAGAAGGAGTAAGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
938369575 2:130760871-130760893 AGCGTGGGACAGCTCGAGGAGGG - Intronic
942493452 2:176512879-176512901 ATCTTTGCACAGATCCAGTATGG - Intergenic
1173044195 20:39493752-39493774 TGTTTGGTACAGATGGAGTATGG + Intergenic
1178005103 21:28209905-28209927 AGCTTGGATCAGGTTGAGTATGG - Intergenic
1179625245 21:42645597-42645619 AGCTTTGTACAGAAGGAGCAAGG + Intergenic
1181859453 22:25806769-25806791 AACTTGGTAAAGAGAGAGTAGGG + Intronic
1185169036 22:49281516-49281538 AGGATGGAACAGATTGAGTAAGG + Intergenic
994087982 5:95781076-95781098 AGGTTGGAACAGATCCAGCAGGG + Intronic
994831791 5:104793032-104793054 TGCTTAGTGCAGATCGAGCAAGG + Intergenic
1008524166 6:52391086-52391108 AACATGGTACAGATGAAGTATGG - Intronic
1010330830 6:74622647-74622669 AACTTGGTACCGATATAGTAAGG + Intergenic
1017806026 6:157946238-157946260 AGCTTGCTACAGATGCAGTGTGG - Intergenic
1024576672 7:50770067-50770089 AGCTTGGCACAGCTTGAGTGTGG - Intronic
1030136677 7:106258346-106258368 AGTTTGGTGGAGATAGAGTAAGG - Intronic
1038667947 8:29557559-29557581 AGCTTGGGACAGATCCCATATGG + Intergenic
1040039843 8:42904797-42904819 AGCTTGGTACAGATCGAGTAGGG - Intronic
1047372907 8:124270813-124270835 AGGGTGGTACAGATTGAGGAAGG + Intergenic
1050363991 9:4856999-4857021 AGTTTGGTATACACCGAGTAGGG + Intronic
1052405411 9:28053550-28053572 AGCTTGCTACAGATCAGATAAGG + Intronic
1053064577 9:35058845-35058867 AGCTTGGTTCAGACTGAGAATGG + Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1060012244 9:120053995-120054017 AGCTTGGTGCACAGTGAGTATGG - Intergenic
1186874820 X:13806708-13806730 AGCATGGTACAGCTCCAGAAAGG - Intronic
1189005825 X:36993687-36993709 AGCTTGGTAAAGATCAACTGTGG - Intergenic
1189042760 X:37560115-37560137 AGCTTGGTAAAGATCAACTGTGG + Intronic
1189731885 X:44029499-44029521 AGCAAAGTACAGATCGAGAAAGG + Intergenic
1193890864 X:87044946-87044968 AAATTGGTACTGATAGAGTAGGG + Intergenic
1194844548 X:98788378-98788400 TGCTTGGAACACATAGAGTAAGG - Intergenic