ID: 1040046286

View in Genome Browser
Species Human (GRCh38)
Location 8:42967258-42967280
Sequence AGGTGTGTGTGGAGGGCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 869
Summary {0: 1, 1: 0, 2: 9, 3: 91, 4: 768}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040046286 Original CRISPR AGGTGTGTGTGGAGGGCAGC CGG (reversed) Intronic
900017493 1:162879-162901 AGATGTGCGTGGAGGTGAGCTGG - Intergenic
900047752 1:521475-521497 AGATGTGCGTGGAGGTGAGCTGG - Intergenic
900069966 1:763339-763361 AGATGTGGGTGGAGGTGAGCTGG - Intergenic
900146670 1:1161672-1161694 AGGTGTCTGTGTGGGGCAGGTGG - Intergenic
900269266 1:1778725-1778747 AGGTGAGTGGGGACGGGAGCCGG - Intronic
900418911 1:2547151-2547173 AGGTGTGTGGGGAGGGCCTGGGG + Intergenic
900524551 1:3122088-3122110 CGGTGTCTGTGGAGGTCAGGCGG + Intronic
900740581 1:4328529-4328551 CCGGGTGTGTGGAGGGCACCTGG + Intergenic
900857886 1:5200584-5200606 GGATGAGTGAGGAGGGCAGCAGG - Intergenic
900991772 1:6101434-6101456 ATGTGTGTGTTGGGGGCGGCAGG - Intergenic
901035112 1:6331785-6331807 AGGTGGGTGTGGCTGGCTGCCGG - Intronic
901143957 1:7052900-7052922 AGGAGTGCGGGGAGGGGAGCAGG - Intronic
901426812 1:9186950-9186972 GGGTGTGTGTGGGGGGGGGCGGG + Intergenic
901526745 1:9827879-9827901 GGGTGTTTGTGGAGCGGAGCCGG + Intergenic
901810205 1:11763075-11763097 TGGTGTGTGTGGAGGACAGTGGG + Intronic
901840637 1:11952029-11952051 AAGTGTCTGTTGAGGGCAGATGG - Intronic
901849516 1:12006718-12006740 AGGTGGGGGCGGAGGGCAGGTGG + Intronic
902117095 1:14130238-14130260 AAATGTGTGGGGAGGGCAGGTGG + Intergenic
902220602 1:14962136-14962158 AGGGGTGTGATGTGGGCAGCAGG + Intronic
902289911 1:15429069-15429091 AGGGATGTGTGGAGGGCAGGCGG - Exonic
902363735 1:15957361-15957383 CGGTGTGTGTGGAGAGGAGGAGG + Intronic
902363745 1:15957400-15957422 CGGTGTGTGTGGAGAGGAGGAGG + Intronic
902410534 1:16209017-16209039 AGGTGGGGCTGGAGGGTAGCAGG + Exonic
902800473 1:18826472-18826494 AGGAGTGGGTGGAGTGCAGCAGG + Intergenic
903331097 1:22597633-22597655 AGGTGTGGAGGGAGGGCAGTGGG - Intronic
903859189 1:26354838-26354860 AGGGGTGCCTGGAGGGCAGGGGG - Intergenic
904281205 1:29419842-29419864 AGGTGTGTGTGGGTGGGAGGGGG - Intergenic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904462462 1:30688242-30688264 AGGAGTGTGTAGAGGGCTGTTGG + Intergenic
905016560 1:34782156-34782178 AGCTGGCTTTGGAGGGCAGCTGG + Intronic
905350246 1:37340856-37340878 AGTAGTGTTTGGTGGGCAGCTGG - Intergenic
905615118 1:39391413-39391435 ATGTGTGTGTGGAGAGGAGGAGG + Intronic
906103029 1:43275204-43275226 ATGTGTGTGTGCATGGCAGGGGG - Intergenic
906127596 1:43437108-43437130 AGAAGTCTGTGGAGGGCAGAGGG + Intronic
906426532 1:45718584-45718606 AGGTGTAGGTGGGGGTCAGCTGG - Intronic
906726664 1:48049175-48049197 AGCTGTCTGAGGAGGGCAGGAGG + Intergenic
907300843 1:53485517-53485539 AGGGGTCTGTGGGGGCCAGCGGG + Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
907853894 1:58282616-58282638 AGGAGTGTGGGGTGGGGAGCAGG + Intronic
908114004 1:60923755-60923777 GGGTGTGGGGGGATGGCAGCCGG + Intronic
908476478 1:64493746-64493768 AGGTGTGTGTGGCAGGGAGGAGG - Intronic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
909942533 1:81626919-81626941 GGGTGTGGGTGGAGGGTAGGTGG + Intronic
910429021 1:87143031-87143053 CGCTGTGTGAGGAGGGCGGCAGG - Intronic
910971358 1:92859406-92859428 ATGTGTGTGTTGCGGGCAGGGGG - Intronic
911449847 1:98048820-98048842 AGGTGTGTTTTGCGGGCAGGGGG + Intergenic
912668052 1:111600661-111600683 AGCAGTGTGGGGAGGGCACCAGG + Intronic
913068513 1:115279410-115279432 AGGTGTGTGTGGGGGTGGGCCGG + Intergenic
914244592 1:145876309-145876331 AGGTGTGAGGGGAGGGGAGCCGG - Intronic
915017309 1:152746023-152746045 AGGAGTGTGTGGGGGGCAGGAGG - Intronic
915042636 1:152981698-152981720 AGGTGGGTGGGGAGGGCAGCAGG + Intergenic
915078910 1:153337932-153337954 AGGTGTGGAGGGAGAGCAGCTGG - Intronic
915351096 1:155226799-155226821 AGGTGTGTGAGGTGGGGAGGCGG - Intergenic
915356235 1:155256505-155256527 GAGTGTGTGTGCTGGGCAGCAGG - Intronic
915511218 1:156388108-156388130 AAGTGCGTGTGGACGACAGCAGG + Intergenic
916069528 1:161161714-161161736 AGGTGGGAGTGGTGAGCAGCTGG + Intronic
916233439 1:162562008-162562030 GGGTGTGTGGGCTGGGCAGCCGG + Intronic
916457850 1:164989350-164989372 AGGTGCCTGGGGAGGGCAGCAGG - Intergenic
916692742 1:167206383-167206405 AGGTGTGTGAGGTGGGTACCTGG + Intergenic
916721240 1:167486014-167486036 AGTGGTGTGTGGATGGCAGTGGG - Intronic
917838725 1:178960709-178960731 GTGTGTGTGTGCAGTGCAGCAGG - Intergenic
917954765 1:180083816-180083838 AAGTGTATGTGGCGGGCGGCGGG + Intronic
918039960 1:180907984-180908006 GTGTGTGTGTGGAGTGAAGCAGG + Intergenic
918129416 1:181612226-181612248 AGGTCTCTCTGGAGGGGAGCAGG + Intronic
919892158 1:201983165-201983187 AGGTGAGGGTGCAGGGCGGCTGG - Intronic
919911522 1:202113789-202113811 AGGTATGTGAGGATGGCAGCAGG - Intergenic
920030838 1:203036539-203036561 TGGTGTGTGTGGAGGGGTGGGGG + Intronic
920035358 1:203061650-203061672 AGGACAGTGAGGAGGGCAGCTGG + Exonic
920210162 1:204322218-204322240 AGGGGTGTGTGTAGGGGGGCGGG - Intronic
920232692 1:204481069-204481091 ATGTGTGTGTGGGGTGCAGGGGG - Intronic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
921389656 1:214605758-214605780 CGCTGTGGGTGGAGGGCACCAGG - Intronic
921584274 1:216929472-216929494 GTGCGTGTGTGGAGGGGAGCTGG + Intronic
921650119 1:217667948-217667970 AATTGTCTGTGGAGAGCAGCAGG - Intronic
921926189 1:220711720-220711742 ATGTGTGTGTTGAGGGGAGTGGG - Intergenic
922105338 1:222508796-222508818 AGATGTGAGTGGAGGTGAGCTGG - Intergenic
922265672 1:223981375-223981397 AGATGTGGGTGGAGGTGAGCTGG - Intergenic
922770882 1:228182459-228182481 GGGTGTGTGTGGTGGGGAGATGG + Intergenic
922784154 1:228274840-228274862 AGGTGAGTGTGGGGGGCAGCAGG + Exonic
923149115 1:231218022-231218044 AGGTGTCTGTGAAGGAGAGCTGG - Intronic
923447887 1:234089452-234089474 TGGTGGGTGTTGAGTGCAGCTGG + Intronic
924010772 1:239663175-239663197 AGGTGAGAGTGGAGAGCAGCAGG - Intronic
924333297 1:242962335-242962357 GGGTGTGTGTGGAGTGTAGAGGG + Intergenic
924347510 1:243086327-243086349 AGATGTGGGTGGAGGTGAGCTGG - Intergenic
924484038 1:244462250-244462272 AGGTGTGTGGGGTGTGCAGATGG - Intronic
924597855 1:245463052-245463074 AAGTGTGGGTGGAGGACAGAGGG - Intronic
924664620 1:246058325-246058347 AGGTGGGGGAGGAGGGCAGGAGG + Intronic
1062831428 10:608398-608420 GGGTGTGTGTGGGGGGCTGTGGG - Intronic
1062904494 10:1170685-1170707 AGCTCTGTGTGGAGGGGAGAGGG - Intergenic
1064000833 10:11662611-11662633 AGCTGTGTGTTGGGGGCAGGAGG - Intergenic
1064156211 10:12905442-12905464 GGATGGGTTTGGAGGGCAGCTGG + Intronic
1064203867 10:13306374-13306396 ACGTGTGTGTGCAGGGAGGCTGG + Intergenic
1064598665 10:16971771-16971793 AGTTGTGTGAAGAGGGCAGGTGG - Intronic
1064859848 10:19815815-19815837 AGGTGGGTGTGGGGCGCAGTTGG + Intergenic
1065044419 10:21733857-21733879 AGGAGTGAGTGGAGTTCAGCAGG + Exonic
1065678303 10:28202332-28202354 AGGTGTGTGTAAATGACAGCTGG + Intronic
1066312350 10:34210233-34210255 ATGTGTGTGTGTAGTGCAGGTGG + Intronic
1066609812 10:37230849-37230871 AGGTTTGTGTGGAAGACAGAAGG + Intronic
1066728843 10:38418543-38418565 AGATGTGGGTGGAGGTGAGCTGG + Intergenic
1067477464 10:46576388-46576410 AGGTGGGGGTGCATGGCAGCTGG + Intergenic
1067617276 10:47765396-47765418 AGGTGGGGGTGCATGGCAGCTGG - Intergenic
1068290996 10:55001365-55001387 AAGTGTGTGTGTAGAGCAGGGGG - Intronic
1068351069 10:55845914-55845936 GGCAGTGTGTGGGGGGCAGCAGG - Intergenic
1068721063 10:60246846-60246868 GGGTGTGTGTGGGGAGAAGCAGG - Intronic
1068848073 10:61703758-61703780 AACTGTGTGTAGGGGGCAGCAGG - Intronic
1068955666 10:62817346-62817368 GGGTGTGTGAAGAGGGCAGCGGG - Intronic
1069319167 10:67146089-67146111 GTGTGTGTGTGGAGGGGTGCTGG - Intronic
1069659101 10:70111817-70111839 AGGAGAGTGTGAAGGGCAGAGGG - Exonic
1069948035 10:72000867-72000889 GGGGGTGTGGGGAGGCCAGCAGG + Intronic
1069961872 10:72083943-72083965 AGGTGTGTGGGGTGGGAAGCAGG + Intronic
1071017477 10:81015054-81015076 ATGTGTGTGAGGGGGGCAGAGGG + Intergenic
1071288962 10:84174383-84174405 AGGTGTGTGTGGTAGGGAGGTGG + Intronic
1071291734 10:84194042-84194064 TGATCTGTGTGGTGGGCAGCAGG - Intergenic
1071523719 10:86346404-86346426 GCCTGTGTTTGGAGGGCAGCTGG + Intronic
1072187866 10:93059944-93059966 GGGTGTGTGTGGAGGGGTGCAGG - Intergenic
1072263204 10:93702354-93702376 GGGTGTGTGAGGAGGGCTGTGGG - Exonic
1072811619 10:98466974-98466996 AGGTGGGGGTGGAAGGGAGCTGG - Intronic
1072922505 10:99588258-99588280 AGGTTTCTGTTGAGGGCGGCAGG + Intergenic
1073432389 10:103494609-103494631 GGCTGGGGGTGGAGGGCAGCCGG + Intronic
1073699375 10:105908239-105908261 TGGGGTGTGTGAGGGGCAGCAGG + Intergenic
1075082607 10:119393888-119393910 ATGTGTGTGTGTAGGGGTGCGGG + Intronic
1075095691 10:119469162-119469184 AGGTGACTGTGGTGAGCAGCAGG - Intergenic
1075278054 10:121113034-121113056 AGCTGAGGCTGGAGGGCAGCAGG + Intergenic
1076054847 10:127364080-127364102 GGGTGTTTGTGGAGTGCAGGGGG + Intronic
1076066262 10:127450586-127450608 AGGTGTGTGTGATGGGCATGAGG + Intronic
1076597276 10:131631860-131631882 AGGTGCCTGTGGTGGCCAGCAGG + Intergenic
1076597294 10:131631941-131631963 AGGTGGCTGTGGTGGCCAGCAGG + Intergenic
1076597325 10:131632103-131632125 AGGTGCCTGTGGTGGCCAGCAGG + Intergenic
1076764848 10:132627405-132627427 AGGTGGGTCTGGAGGGCGGTGGG + Intronic
1076854924 10:133111330-133111352 AGGTGCCTGTGGTGGGCAGGTGG - Intronic
1076855061 10:133111792-133111814 AGGTGCCTGTGGTGGGCAGGTGG - Intronic
1076855087 10:133111876-133111898 AGGTGTCTGTGGTGGGCAGGTGG - Intronic
1076855111 10:133111960-133111982 AGGTGCCTGTGGTGGGCAGGTGG - Intronic
1076855122 10:133112002-133112024 AGGTGTCTGTGGTGGGCAGGTGG - Intronic
1076974090 11:158085-158107 AGATGTGCGTGGAGGTGAGCTGG - Intergenic
1077138885 11:1014839-1014861 AGCTGGGAGGGGAGGGCAGCTGG - Intronic
1077292430 11:1804137-1804159 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292448 11:1804187-1804209 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292454 11:1804203-1804225 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292472 11:1804253-1804275 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292478 11:1804269-1804291 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292484 11:1804285-1804307 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077299501 11:1840474-1840496 AGGTGGGTCTGCAGGGGAGCTGG + Intronic
1077358814 11:2130772-2130794 AGGGGTGGGTGGGGGGCAGTGGG - Intronic
1077577334 11:3394471-3394493 AGGAGAGTGTGGTGGGCAGATGG - Intergenic
1077762615 11:5119442-5119464 GGGTGTTTGTGGAAGGCAGGTGG + Intergenic
1078088930 11:8251765-8251787 TGGTGTGTGTGGAGGGGTGGAGG + Intronic
1078333377 11:10444384-10444406 ATGTGTGTGTGGTGGGCAGGTGG + Intronic
1078974185 11:16452072-16452094 ATGTGTGTGTTGAGTACAGCTGG + Intronic
1079271820 11:18994155-18994177 GGGTGTGTGTGGGGGGAAGTGGG - Intergenic
1081432961 11:42996691-42996713 GTGTGTGTGTGGAGGGCGGGGGG - Intergenic
1081512019 11:43784453-43784475 AGGTGGGGGTGGGGGGCAGCAGG + Intronic
1081751047 11:45511609-45511631 AGATGAGAGAGGAGGGCAGCTGG - Intergenic
1081961787 11:47143248-47143270 AGGTATGTGTGTGGGGAAGCTGG - Intronic
1081977517 11:47245082-47245104 AGCTCTGGGTGGAGAGCAGCAGG + Intronic
1081991782 11:47341970-47341992 CGGTGAGTGTGCAGGGCAGGTGG - Exonic
1082832702 11:57630917-57630939 AGATGTGTGAGGTGAGCAGCTGG - Intergenic
1083553262 11:63606761-63606783 AGGCGTGCGGGGAGGGCAGAGGG + Intronic
1083681343 11:64353239-64353261 AGGTGTGGCTGGAGGGCCGGTGG + Exonic
1083922694 11:65788969-65788991 AGGTGAGGGTGGAGGGCGGAGGG - Intronic
1084004337 11:66315166-66315188 AGGAGGGTGGGGAGGGCTGCGGG + Exonic
1084180346 11:67442902-67442924 TGGTGTGTGTCGGGGGCAGGAGG + Intronic
1084264833 11:67999498-67999520 AGGTGAGCCTGGTGGGCAGCAGG - Exonic
1084268186 11:68015499-68015521 AGGGGGGCATGGAGGGCAGCTGG + Intronic
1084364768 11:68690418-68690440 AGGAGTGAGGGGAGGGGAGCGGG + Intronic
1084495038 11:69498561-69498583 AGGTGTAGGTGGAGGGGTGCAGG + Intergenic
1084528389 11:69711976-69711998 AGGGGTGTGTTTGGGGCAGCAGG + Intergenic
1084680334 11:70662979-70663001 AGGCCTCTGTGGAGGGGAGCGGG + Intronic
1085026431 11:73239276-73239298 GGGTGTGGGAGGAGGGAAGCAGG + Intergenic
1085048657 11:73368118-73368140 AGGGTTTTCTGGAGGGCAGCAGG + Exonic
1085396650 11:76210047-76210069 GGGTGTGTGTGGTGGGCGGGGGG - Intronic
1085404723 11:76255003-76255025 AGGTGTGTGTGCAGGGGTGGGGG + Intergenic
1085465814 11:76722521-76722543 AGGTGTGTATGCAGGGCACAGGG - Intergenic
1085716985 11:78881246-78881268 GAGTGAGTGTGGAAGGCAGCGGG - Intronic
1085745861 11:79113693-79113715 AGGTGTGTGTGGTGGACATTGGG + Intronic
1086124243 11:83333596-83333618 AGGTGAGTATGGAGGGGAGTTGG - Intergenic
1086336849 11:85809763-85809785 AGAGGTGTGGGGACGGCAGCAGG - Intronic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087293532 11:96343667-96343689 ATGTGTGTGTTGAGGGCGGAAGG + Intergenic
1087934629 11:104018137-104018159 GGGTGTGTGTGGAGGGGGGTGGG - Intronic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088495437 11:110427323-110427345 ATTTGTGTTTGGTGGGCAGCAGG - Intergenic
1088645423 11:111913096-111913118 AAGTGTGTCTTGAGGTCAGCAGG - Intronic
1088987125 11:114919038-114919060 AAGAGTGTGTGGGGGGCAGTGGG - Intergenic
1089164239 11:116462390-116462412 AGATGTGTGTGCAGGGATGCAGG - Intergenic
1089194285 11:116684053-116684075 GGGTGGGGGTGGAGGGGAGCGGG - Intergenic
1089297824 11:117480594-117480616 AGGGAAGTGAGGAGGGCAGCAGG + Intronic
1089399574 11:118156678-118156700 GGGTGTGTGTGGGGGGAGGCGGG - Intergenic
1089403052 11:118175916-118175938 AGGAGAGTGTGCAGGGGAGCTGG - Intronic
1089465022 11:118679514-118679536 AGGGGTGTGGGGAAGGCAGCAGG - Intronic
1089496913 11:118912616-118912638 AGTTGTGTGTGGAGCAGAGCCGG - Intronic
1089627759 11:119762368-119762390 AGGTGTGTGCCGAGGGCACCAGG + Intergenic
1089697981 11:120227514-120227536 AGGTGTCAGTGGAGGGGGGCAGG - Intronic
1089868301 11:121651022-121651044 AGGAGTGTCTGGAGAGCAGGAGG + Intergenic
1090068727 11:123525758-123525780 AGGTGAGGGTGGGGGGCAGCCGG + Exonic
1090255993 11:125284813-125284835 AGCTGGGGGTGGAGGACAGCAGG - Intronic
1090274428 11:125409642-125409664 GGAGGTGTGTGGAGAGCAGCCGG + Intronic
1090359121 11:126160508-126160530 TGGAGTGAGGGGAGGGCAGCAGG + Intergenic
1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG + Exonic
1090391729 11:126393302-126393324 AGGTATGTGAGGTGGGTAGCTGG + Intronic
1090568476 11:128021573-128021595 ATGTGTGTCTGCTGGGCAGCAGG + Intergenic
1091249801 11:134133764-134133786 AGGTGTGTGTGTAGGGGGGAAGG - Intronic
1091254455 11:134171811-134171833 TGCTGTGTTTGGAGGACAGCCGG - Intronic
1091449458 12:563320-563342 AGGGGTGTGGGCAGGGCAGGAGG - Exonic
1091563193 12:1629958-1629980 AGGTGTGTGGGGCCGGCAGGGGG - Intronic
1091675601 12:2486809-2486831 AGGTGGGGGAGGAGGGCAGGTGG + Intronic
1091844746 12:3647185-3647207 AGGTGGGGGTGGGGGACAGCGGG - Intronic
1092973479 12:13721374-13721396 TGTTGTGTGGGGAGGGCAACTGG + Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1096072382 12:48782534-48782556 AGGTAGGGATGGAGGGCAGCAGG - Intronic
1096323970 12:50641660-50641682 AGGTGTGCCTGCATGGCAGCGGG + Intronic
1096358762 12:50965628-50965650 AGGGGTTTGTGGAGGTCAGGTGG - Intronic
1096604922 12:52757835-52757857 AGGTGGGTGTGGAGGCAGGCAGG - Intergenic
1096740319 12:53688765-53688787 AGGTAAGGGTGGAGGGCAGCAGG - Intergenic
1096788559 12:54031518-54031540 AGGCGGGTGAGGAGCGCAGCCGG + Intronic
1096801867 12:54115718-54115740 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1096804773 12:54133919-54133941 AGGAGCGGGTGGTGGGCAGCGGG - Intergenic
1096925105 12:55135485-55135507 AGGTGTGTGTGGAGTCTAGCAGG - Intergenic
1096982415 12:55736119-55736141 AGGTGAGTGTGAGGGGCAGAAGG - Intergenic
1097088346 12:56486300-56486322 AGGTGTGTGTGTGGGGAACCAGG + Intronic
1097146223 12:56941174-56941196 AGGAGTGTGTGGGGGACAGAGGG - Intergenic
1097151940 12:56985651-56985673 AGGAGTGTGTGGGGGACAGAGGG - Intergenic
1097272261 12:57783284-57783306 GTGTGTGTGTGGAGGGGTGCAGG + Intronic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098041080 12:66354571-66354593 AAGTCTTTGTGGAGGGCATCTGG - Intronic
1098149788 12:67534944-67534966 AGGTGGTTGTGGAGGGGAGTTGG + Intergenic
1098160870 12:67648029-67648051 AGGCGCGTGTGGACGGCAGCTGG - Intergenic
1099915757 12:88891296-88891318 TGGTGTGGGGGGAGGGCAGTGGG - Intergenic
1101093635 12:101313710-101313732 GGGTGTGTGTGGTGGGGAGTGGG + Intronic
1101556953 12:105819013-105819035 GGGTGTGTGTGGAAGGAAGATGG + Intergenic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1103345665 12:120248405-120248427 AGGTGTCTGCTGAGGGCAGTGGG - Intronic
1103724488 12:122990972-122990994 AGGGGTGTGTGTGGGGCAGGAGG - Intronic
1104440815 12:128791922-128791944 AGGTGTGTGGGAAGGGGACCGGG + Intergenic
1104464702 12:128980740-128980762 AGCTTTGTGTGGAAGGCAGACGG + Intronic
1104549060 12:129739288-129739310 AGGTGTGGGTGGAGTCCAGGTGG + Intronic
1104746880 12:131216160-131216182 GGGTGTCTGGGGAGAGCAGCTGG - Intergenic
1104762367 12:131305174-131305196 AGGTGTGAGTAGAGGGTCGCTGG - Intergenic
1104785737 12:131447023-131447045 GGGTGTCTGGGGAGAGCAGCTGG + Intergenic
1104817409 12:131655622-131655644 AGGTGTGAGTAGAGGGTCGCTGG + Intergenic
1104845024 12:131842332-131842354 TGGGCGGTGTGGAGGGCAGCTGG - Intronic
1104994006 12:132642891-132642913 AGGTGTGTTTGGGGGGTGGCAGG + Exonic
1105916475 13:24921824-24921846 AGGTGTGTTTGGTGGGGAGTTGG - Intronic
1106522686 13:30511811-30511833 AGGTGTGTGTTTGGGGCAGTGGG - Intronic
1108744426 13:53377034-53377056 GGGTGTGTGTGGGTGGGAGCTGG + Intergenic
1110763247 13:79253429-79253451 AGCTGTGTGTGGAGGAAAGAAGG - Intergenic
1111337522 13:86841489-86841511 AGGTGTGTTCCCAGGGCAGCAGG + Intergenic
1113335669 13:109373646-109373668 AATTGTGTGTGGAGGGGTGCGGG + Intergenic
1113657245 13:112074687-112074709 CGTTGTTTGTGGAGAGCAGCAGG + Intergenic
1113667945 13:112153962-112153984 AGGTGTGTGTGGGAGGAAACAGG - Intergenic
1113731189 13:112642612-112642634 AGGAGTGGGTGGCGGGCAGGCGG - Intergenic
1113781165 13:112978363-112978385 AGGTGGGTGTGGAAGGCAGGAGG + Intronic
1113882678 13:113636431-113636453 AGCTGTGTGTGGCGGTCAGCGGG + Intronic
1113957097 13:114104882-114104904 ACGTGTGTGGGGAGGGGAGTGGG - Intronic
1113957105 13:114104908-114104930 ACGTGTGTGGGGAGGGGAGGGGG - Intronic
1114658464 14:24330112-24330134 GGGTGGATGTGGGGGGCAGCAGG - Intronic
1114755255 14:25252609-25252631 TGGTGTGTATGTAGGGCAGCTGG + Intergenic
1115620829 14:35138594-35138616 AGGTGTTTATGGAGGTCAGTTGG - Intronic
1115754167 14:36517209-36517231 TGGTCTGTGTGGCGGGCAGGAGG + Exonic
1115960047 14:38825740-38825762 AATTGTGTGTGGAGGGCTGGGGG - Intergenic
1118050345 14:62019778-62019800 AGGTGTGATTGCAGTGCAGCGGG + Intronic
1118110307 14:62711215-62711237 GGGGGTGGGTGGGGGGCAGCTGG - Intronic
1118335494 14:64850311-64850333 AGGTGTGTGTGGACAGCCTCTGG - Intronic
1118750646 14:68805835-68805857 AAGTGTGAGTGGAGGGAAACTGG + Intergenic
1119179752 14:72597894-72597916 AGGAGGGTGTGGAGAGCTGCCGG - Intergenic
1119644321 14:76337544-76337566 AGGTGTGTGTGGGCGGGGGCTGG + Intronic
1119738746 14:77000269-77000291 AGGGGTGGGTGGGGGCCAGCTGG + Intergenic
1119740006 14:77008103-77008125 AGGTGTGGGTGAAGGGCAGCAGG + Intergenic
1119877449 14:78072952-78072974 AGGTGTGTGTGGAGGTGAGCAGG - Intergenic
1122058304 14:99119848-99119870 AGCTGGGTTTGGAGAGCAGCAGG + Intergenic
1122120578 14:99551431-99551453 AGGTGGGTGTGCAGGTGAGCAGG + Intronic
1122627630 14:103092334-103092356 AGGTGCCTGTGGAGAGCAGATGG + Intergenic
1122630810 14:103107011-103107033 GGGTGTGTGTGTAGGGTAGTGGG + Intronic
1122690099 14:103528219-103528241 GAGTGTGTGTGCAGGGGAGCGGG - Intergenic
1122692440 14:103537685-103537707 CTGGGTGGGTGGAGGGCAGCAGG + Intergenic
1122694730 14:103547079-103547101 GGGGCTGTGTGGAGGGCGGCAGG + Intergenic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1122819618 14:104334951-104334973 GGGTGTGTGCGGAGGGCTGTGGG - Intergenic
1122932479 14:104940702-104940724 AGGTGCCTGGGGATGGCAGCTGG + Exonic
1122951554 14:105047809-105047831 GGCTGTGGGCGGAGGGCAGCAGG - Intergenic
1123037564 14:105477709-105477731 GGGTGTGTGTGGGGGGAAGCGGG + Intronic
1123044063 14:105502935-105502957 AGGTGGGTTTGGAGGACAGCTGG + Intergenic
1123805247 15:23864580-23864602 AAGTGTGTGTGGAGGGTAGTGGG - Intergenic
1124018005 15:25894449-25894471 GGGTTGGTGGGGAGGGCAGCAGG - Intergenic
1124530434 15:30500750-30500772 ATTTGTGTCTGGAGGGCAGGGGG - Intergenic
1124768225 15:32506938-32506960 ATTTGTGTCTGGAGGGCAGGGGG + Intergenic
1124957052 15:34366732-34366754 AGGTGGGGATGGAGGGCTGCAGG - Intronic
1125477061 15:40054716-40054738 AGGGGTGTGGGGTGGGAAGCTGG - Intergenic
1126277404 15:46900389-46900411 AGGGGTGTGTGGAGGTCTTCAGG - Intergenic
1127110907 15:55669396-55669418 TGATGTGTCTGGAGGGCAGTAGG - Intronic
1128212722 15:65913688-65913710 ATGTGTGTGTGGAGGGGAAGAGG + Intronic
1128967378 15:72072743-72072765 AGGAGTGTGAGGAGGGGAGGAGG + Intronic
1129172780 15:73818061-73818083 TGGTGTTTGTGGAGGCCAGGTGG + Intergenic
1129332457 15:74834641-74834663 AGGTAGGTGTGGAGAGCAGTGGG - Intergenic
1129520196 15:76181103-76181125 AGGTCCCTGGGGAGGGCAGCTGG + Intronic
1130011224 15:80154230-80154252 AAGTGTTTGAGGAGGGCAGAGGG - Intronic
1130529852 15:84738529-84738551 TGATGTGTGTGGAGGACAACAGG + Intergenic
1130747350 15:86669832-86669854 AAGTGTGTGTGGAGGGGAGTGGG + Intronic
1130865947 15:87933468-87933490 AGGTGAGTGTACATGGCAGCTGG + Intronic
1131110601 15:89762111-89762133 AGGTGTGTGGGCAGTGCTGCTGG + Intronic
1132013732 15:98298203-98298225 AGGTGTGTGTGGGGGGTGGGTGG - Intergenic
1132302929 15:100787685-100787707 GGGTGTGTGGGGAAGGCAGCAGG - Intergenic
1133103111 16:3491111-3491133 AGGTGTGGGTGGGATGCAGCGGG - Intergenic
1133300166 16:4777735-4777757 AGGTGTGTGTTGAGAGCCGCTGG + Exonic
1134070165 16:11255777-11255799 AGGGGGGCGTGGAGAGCAGCCGG + Intronic
1134633864 16:15777571-15777593 AGAGGTGTGTGCAGGGCTGCAGG + Intronic
1134683932 16:16145771-16145793 ATGTGTGTGTGGGGGGCTGGGGG - Intergenic
1135111033 16:19691098-19691120 ATGTGTGCGTGGCGGGGAGCGGG - Intronic
1136542381 16:30935349-30935371 AGGCGTGTGTAGGGGACAGCAGG + Intronic
1137758360 16:50920279-50920301 GGCTGTGTGAAGAGGGCAGCTGG + Intergenic
1137779734 16:51087891-51087913 AAGTGAGTGTAGAAGGCAGCAGG - Intergenic
1138026006 16:53523020-53523042 AGGTCAGTGAGGAGAGCAGCAGG - Intergenic
1138167839 16:54819445-54819467 AGGTGTGTGTAGTGGGTAGAGGG + Intergenic
1138450981 16:57093202-57093224 AGGGGTGGGAGGAGGGCAGAGGG - Intronic
1139578555 16:67857868-67857890 AGGTGTGGGTGGAGGGGAAGTGG + Intronic
1140077650 16:71716654-71716676 TGGTGTGTTTGGAGAGCTGCAGG - Intronic
1140459848 16:75130947-75130969 AGATCTGTGGGGAGGTCAGCAGG - Intergenic
1140537814 16:75727024-75727046 AGGTTTTTCTGGAGGGAAGCGGG + Intronic
1141234340 16:82201419-82201441 TGATGTGTGAGGAGGTCAGCTGG + Intergenic
1141428602 16:83959322-83959344 GGGTGTGGGTGGATGGCATCTGG - Exonic
1142178850 16:88657517-88657539 AGCTGAGGCTGGAGGGCAGCGGG + Exonic
1142200692 16:88759884-88759906 AGCTGTGTGGGGAGGGGACCTGG + Intronic
1142356039 16:89602515-89602537 CGGTGGGTGGGGGGGGCAGCTGG + Intergenic
1142368440 16:89663685-89663707 GGGTGTGTCTGAAGGGCAGCAGG + Intronic
1142378200 16:89717565-89717587 AGTTTTCTGTGAAGGGCAGCAGG - Intronic
1142427539 16:90008692-90008714 AGGTGTGTGTGGTGGGCTGAGGG - Intronic
1142446168 16:90139578-90139600 AGATGTGCGTGGAGGTGAGCTGG + Intergenic
1142495223 17:302645-302667 GGGTGAGTGTGGGTGGCAGCCGG - Intronic
1142702066 17:1668835-1668857 AGGTGTGTTGGGAGCTCAGCTGG - Intronic
1143375740 17:6466078-6466100 AGGTGTGGATGGGGAGCAGCAGG - Intronic
1143565480 17:7717830-7717852 AGGTGTGTGTCGGGGGCAGAGGG + Exonic
1144036029 17:11366801-11366823 TGGTGTATGTGGAGGGTTGCAGG + Intronic
1144078127 17:11737315-11737337 AGGGGTGGGTGGGGGGCAGCTGG - Intronic
1144095854 17:11900195-11900217 AGTGGTGTGTGGAGTGGAGCAGG - Intronic
1144473287 17:15563272-15563294 AGTTGTCTGAGGAGGGCTGCTGG - Intronic
1144782562 17:17815344-17815366 AGGTGAGTGGGGTGGGGAGCAGG + Intronic
1144923195 17:18781448-18781470 AGTTGTCTGAGGAGGGCTGCTGG + Intronic
1145279820 17:21458745-21458767 GTGTGTGTGTGGCGGGGAGCAGG + Intergenic
1146211679 17:30948090-30948112 AGGTGTGTGTGGGATGGAGCGGG + Intronic
1146466631 17:33091323-33091345 GGGTGAGTGTGGAGGGCTGTTGG + Intronic
1146953201 17:36920825-36920847 AGGTGAGGGTGGAGGGCTGGAGG + Intergenic
1147258732 17:39196815-39196837 GGGTGTGGGGGGAGGGGAGCAGG + Intronic
1147314234 17:39611970-39611992 GAGTGTGTGTGGAGGGGAGGTGG + Intergenic
1147689904 17:42308660-42308682 AGCAGGGTGTGGAGAGCAGCTGG - Intronic
1148135335 17:45288276-45288298 AAGATTGTGGGGAGGGCAGCTGG - Intronic
1148737824 17:49874663-49874685 AGGTGGGCGTGGAGGGGAGGGGG - Intergenic
1148865347 17:50625507-50625529 ACCTATGTGTGGAGGGCAGCAGG + Intronic
1149588675 17:57811221-57811243 AGGGGTGGGTGGGAGGCAGCGGG - Intergenic
1149661187 17:58334843-58334865 AGGTGTGTGTACAGGACTGCGGG - Intergenic
1151139961 17:71981974-71981996 ACATGTGTGTGGAGGGTAGGTGG - Intergenic
1151401353 17:73857946-73857968 AGGGGTGTGGGGAGGGTGGCTGG + Intergenic
1151575251 17:74949883-74949905 AGGTGTGTGGGGAGAGGAGCTGG - Exonic
1151644493 17:75420776-75420798 GGATGTGTGTGCAAGGCAGCAGG + Intergenic
1151966004 17:77432036-77432058 AGCTGGGGGTGGGGGGCAGCAGG + Intronic
1152130381 17:78472631-78472653 TGGGGTGTGGGGAGGGGAGCTGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152240284 17:79157348-79157370 AGGGGTGCATGGACGGCAGCTGG - Intronic
1152508850 17:80771708-80771730 GGGGGTGGGTGGAGGCCAGCTGG + Intronic
1152811329 17:82384143-82384165 GGGTGTGGGTGGAGGGTAGCAGG - Intergenic
1153644713 18:7184962-7184984 TCGTGAATGTGGAGGGCAGCAGG - Intergenic
1153993790 18:10422706-10422728 AGGGATGTGTTGAGGGAAGCTGG - Intergenic
1154015629 18:10614464-10614486 AGGGGTGTGTAGGGGGCAGGAGG - Intergenic
1154189885 18:12221179-12221201 AGGGGTGTGTGGGGGGCAGGAGG + Intergenic
1154355298 18:13619942-13619964 GGGTGGGAGTGGAGGGCAGTGGG - Intronic
1155241429 18:23867137-23867159 AGGAGGGTGGGGAGGGCAGAGGG - Intronic
1156061823 18:33086807-33086829 TGGTGTGTGTGAAGGGGAGAGGG + Intronic
1156129396 18:33952130-33952152 ATGTGTTTGTGGTGGGAAGCTGG + Intronic
1156253352 18:35373392-35373414 AGATGTGTGTGGTGAGCAGAGGG + Intronic
1156365066 18:36418531-36418553 AAGTGTGTGTGGAAGGCACATGG + Intronic
1156449403 18:37258581-37258603 AGGTGAGTGGGGAGGGCAGGAGG + Intronic
1156631176 18:38971144-38971166 AGGAGTCTGTGGAGTGCAGAGGG - Intergenic
1156991541 18:43414559-43414581 AGGTGTGTGTGTGTTGCAGCTGG + Intergenic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1160446717 18:78933890-78933912 AGGTGAGTGTGTAGCACAGCAGG - Intergenic
1160520723 18:79506457-79506479 AGGGCTGTGTGGAGGGCAGACGG - Intronic
1160543986 18:79640786-79640808 AGGAGGGTGTGGTGGGCATCTGG - Intergenic
1160651038 19:228252-228274 AGATGTGCGTGGAGGTGAGCTGG - Intergenic
1160700057 19:501823-501845 GGGTGTGTGTGGAGCCCTGCTGG - Exonic
1160900532 19:1425748-1425770 AGCTGTGTGTGGGGCGCTGCGGG - Intronic
1161234475 19:3191001-3191023 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161234487 19:3191063-3191085 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161628067 19:5338492-5338514 AAGGCTTTGTGGAGGGCAGCGGG + Intronic
1161768153 19:6217933-6217955 AGGTGTGTATGGAGAGCAGCTGG - Exonic
1161793645 19:6374699-6374721 GGGTCTGTGTGGGAGGCAGCAGG + Intronic
1162139544 19:8577505-8577527 AGCTGGGTGTGGAGGGGGGCGGG + Exonic
1162496528 19:11026225-11026247 CGGTGTGTGCGGACCGCAGCGGG + Intronic
1162500612 19:11051326-11051348 AGGTGTGTGGAGTTGGCAGCAGG + Intronic
1162531602 19:11239417-11239439 AGGTGTGGGTGGGGGGCATTGGG - Intronic
1163283598 19:16332284-16332306 ACCTGTGTGTGGAGGGAAACAGG - Intergenic
1163289368 19:16369452-16369474 AGGTGTGTGAGGTGGGCAGGGGG + Intronic
1163536872 19:17881939-17881961 TGCTGTGTGAGGAAGGCAGCGGG - Exonic
1164463884 19:28471188-28471210 AAGGATGTGTGGAGGGCAGGGGG - Intergenic
1164835887 19:31354836-31354858 AGGTGTGCCTGGATGGGAGCTGG + Intergenic
1165778960 19:38421054-38421076 AGCTATGGGTGGAGGGCAGAGGG - Intronic
1166053230 19:40273682-40273704 AGGTGTGTGTGTGGGGTGGCAGG - Intronic
1166080634 19:40442007-40442029 AGGTGGGAGTGGAGTCCAGCAGG - Exonic
1166111716 19:40626920-40626942 TGGTGGGTGTGGGGGCCAGCAGG + Intronic
1167147966 19:47694198-47694220 TGGGGTGTGGGGAGGGCAGGTGG - Exonic
1167458973 19:49614501-49614523 AGGGGTGTGGTGAGGCCAGCAGG - Intronic
1168103852 19:54155173-54155195 GTGTGTGCGTGCAGGGCAGCTGG + Exonic
1168121025 19:54252593-54252615 AGTTGTGTGTGCAGGGCAGCTGG - Intronic
1168124603 19:54276500-54276522 AGCTGTGTGTGCAGGGCAGGGGG - Intronic
1168177384 19:54635038-54635060 AGCTGTGTGTGCAGGGCAGGGGG + Intronic
1168273758 19:55265183-55265205 AGGTGTGTGGGGAGGGGATGGGG - Intronic
924964579 2:63579-63601 AGGGGTGTGTGGATGGAAGCAGG - Intergenic
924974768 2:162585-162607 GGGCGTGTCAGGAGGGCAGCGGG - Intergenic
925254014 2:2466807-2466829 GGGGATGTGTGAAGGGCAGCAGG - Intergenic
925388494 2:3479896-3479918 GGGTGTGTGGGGAGGGCAAGAGG - Intronic
925551067 2:5074985-5075007 TGGTGTGTGGGGTGGGGAGCTGG - Intergenic
926231837 2:11010278-11010300 AGGTGTGTGAGGACTGCAGGAGG + Intergenic
926676403 2:15626182-15626204 GGGTATGTGTGGAGGGGAGAGGG - Intronic
927147642 2:20177477-20177499 AGGTGTGTGTAGAGGATAGATGG + Intergenic
927912192 2:26907595-26907617 GGGTGCGTGTGGGGAGCAGCTGG - Intronic
928078112 2:28283673-28283695 AGGTAGGTGTGGAGGGAACCAGG + Intronic
928398434 2:30960870-30960892 AAGGGTGTGGGGAAGGCAGCTGG - Intronic
928624115 2:33122026-33122048 ATGTGTGTGTGGAGGGGGGCAGG - Intronic
929643499 2:43604903-43604925 TGGTGTGTGTGGAAGGAAGAGGG - Intergenic
929763612 2:44826212-44826234 AGATTTGTCTGGAGGGCAGAAGG - Intergenic
929879985 2:45827114-45827136 AGCAGAGTGTGGAGGGCAGTTGG - Intronic
929911262 2:46091241-46091263 AAGTGTATGGGGAGGGCAGGTGG - Intronic
930000331 2:46856841-46856863 ACGTGCCTGTGGAGGTCAGCAGG - Intronic
930017214 2:46979184-46979206 AGGGGAGGGTGGAGGGCATCTGG + Intronic
930361867 2:50390746-50390768 ATGTGTGTGTTGAGGGGAGGTGG - Intronic
930704912 2:54495184-54495206 AGGTTGGTCTGGAGGACAGCAGG + Intronic
930851511 2:55965936-55965958 AGGTGTGTGTGAAGGGAAGGAGG + Intergenic
930852930 2:55980944-55980966 AGGAGGGTGTGAATGGCAGCTGG - Intergenic
932414598 2:71566001-71566023 GTGTGTGTGTGTTGGGCAGCAGG + Intronic
933164691 2:79063265-79063287 AGGTGTGTGGGGAGGGGTGTTGG + Intergenic
933166924 2:79086791-79086813 ATGTGAGTGAGGAGAGCAGCAGG - Exonic
934495796 2:94796728-94796750 AAGGGTGTGTGGAAGGCAGAAGG - Intergenic
934527056 2:95058547-95058569 AGGTGTGTGTCGAAGGCTGGGGG + Intergenic
935447928 2:103176177-103176199 AAGGGTGTGTGCAGGGGAGCGGG - Intergenic
935645303 2:105329604-105329626 CGGTGAGTGAGGAGGGCGGCGGG - Exonic
935646523 2:105340367-105340389 AGGTGTGTGGGGAGGGGAAGCGG + Intronic
935976877 2:108586909-108586931 AGGTGGGAGTGGAAGGCAGATGG - Intronic
935979644 2:108614060-108614082 AGGTGTGTGAGGTGCACAGCTGG + Intronic
936400926 2:112163940-112163962 AGATGTCTGGGGAGGGCAGAGGG - Intronic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937042937 2:118835418-118835440 AGGGGTGACTGGAGAGCAGCGGG + Intergenic
937083311 2:119155874-119155896 AGTTGTGGGTGGAGGTCAGAGGG - Intergenic
937087773 2:119182600-119182622 AAGTGTGTGTTGGGGGGAGCTGG - Intergenic
937276143 2:120685402-120685424 GGGAGTGTGAAGAGGGCAGCAGG + Intergenic
937304665 2:120863985-120864007 ACTTGTGTGTGGAGGGCGGCTGG + Intronic
937395139 2:121528643-121528665 AGATGTGTTTTGAGGTCAGCTGG - Intronic
937403460 2:121606050-121606072 ATGTGTGTCTGAAGAGCAGCTGG + Exonic
937916403 2:127101182-127101204 GGGTGTTTGTGCAGGGCAGGTGG - Intronic
938128895 2:128694007-128694029 AGGTGTGTGAGCCGGGCGGCAGG - Intergenic
938650135 2:133374558-133374580 AAGTGCGTGTGTAGGGCAGTGGG + Intronic
938650161 2:133374650-133374672 AAGTGCGTGTGTAGGGCAGGGGG + Intronic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
939129513 2:138217529-138217551 ATATGTGTGTGGAGGGCAGTGGG - Intergenic
940039806 2:149348390-149348412 AGGGGTGGGTGGGAGGCAGCTGG + Intronic
940951736 2:159682907-159682929 AGGTGTGTGTGGGGGGGGGGAGG - Intergenic
941377363 2:164748023-164748045 AGCTGTGTGTGGTGGGGAGCAGG + Intronic
942049054 2:172121704-172121726 AGGAGTGTATGGATGGCATCTGG + Intergenic
942470540 2:176255213-176255235 AGGGCTCTGTGGAGGGCAGAGGG - Intergenic
943027662 2:182649048-182649070 AGGTGTGTGTAAGTGGCAGCAGG + Intergenic
943213274 2:184996878-184996900 TGGTGTGTGTGTATGGGAGCAGG - Intergenic
944597109 2:201270987-201271009 AGGGGTGAGGGCAGGGCAGCTGG + Intronic
944734061 2:202545208-202545230 AGGTGTGTGGGGAGGGGAGGGGG - Intronic
945063342 2:205927205-205927227 AGATGTGTGAGGAAGGCAACAGG - Intergenic
945268892 2:207918993-207919015 AGGCGTGTGTGGTGGGCAGTGGG + Intronic
945920071 2:215746828-215746850 AGGTGTGTGGAGCCGGCAGCAGG + Intergenic
946227099 2:218269874-218269896 AGTCGGGTGTGGAGGGGAGCGGG + Intronic
947195200 2:227557381-227557403 GGGTGTGTGTGCAGGGGGGCGGG - Intronic
947536357 2:230942506-230942528 AGGTGTGGGGGGAGAGCGGCAGG + Intronic
947948942 2:234131055-234131077 TCATGTGTGTGGAGGGCAGTGGG + Intergenic
948177810 2:235957975-235957997 AGGTGTGGGTGGAAGTCAGCAGG + Intronic
948271446 2:236676932-236676954 GTGTGTGTGCGGAGGGGAGCAGG + Intergenic
948564645 2:238876131-238876153 GGGTGTGGGTGGAGGGCGGATGG + Intronic
948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG + Intergenic
948794730 2:240396500-240396522 AGGTGTGTGTGGAATCCAGTCGG + Intergenic
948862695 2:240760644-240760666 AGGTGGGGCTGGAGGGCCGCTGG - Exonic
948943840 2:241209645-241209667 AGGCGTGAGCGGAGGGCAGGGGG - Intronic
948962044 2:241346948-241346970 AGGTGAGTGAGGATGGCTGCAGG - Intronic
948981053 2:241494991-241495013 AGGTGTGTGTGGTGGGGCCCGGG - Exonic
949052640 2:241905318-241905340 AGGTGTGTGTGCAGGGCTGTGGG + Intergenic
949059486 2:241948875-241948897 AGGTGGGTGAGCAGGGCTGCGGG + Intergenic
949073496 2:242040718-242040740 AGGCGCGTCTGCAGGGCAGCTGG - Intergenic
1169723866 20:8708012-8708034 AGGTGTGTGGGGTGGGGTGCAGG + Intronic
1170360768 20:15543756-15543778 AGCTGTGTCTGGAAGTCAGCTGG + Intronic
1170578127 20:17680220-17680242 AGGAGTGTGAGGAGGGAGGCGGG + Intronic
1170871762 20:20212656-20212678 AGGTGGGGGTGGAGGATAGCAGG - Intronic
1171458024 20:25282832-25282854 AGGTGCTGGTGGAGGGCAGCGGG + Intronic
1171794844 20:29558748-29558770 GGCTGTGTCTGAAGGGCAGCAGG - Intergenic
1171853612 20:30325517-30325539 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1172281705 20:33712403-33712425 TGGTGTGGGGGGAGGGGAGCAGG - Intronic
1173253302 20:41375783-41375805 AAGGCTGTCTGGAGGGCAGCAGG + Intergenic
1173300644 20:41799364-41799386 AGCTGAGTATGGAGGGAAGCTGG + Intergenic
1173929194 20:46804378-46804400 AGGTGAGTGTTGAGTGCAGATGG - Intergenic
1174130245 20:48339477-48339499 TTGTGTGTGTGGCGGGGAGCTGG - Intergenic
1174489626 20:50883750-50883772 AGGAGTGAGTGGAGGGCAGCAGG + Intergenic
1174718033 20:52781212-52781234 AGGTTTATGTGGGGAGCAGCAGG - Intergenic
1175749223 20:61483688-61483710 GTGTGTGTGTTGGGGGCAGCGGG - Intronic
1175777109 20:61660262-61660284 TGTTGTAAGTGGAGGGCAGCAGG - Intronic
1176058690 20:63162307-63162329 AGGTGTTTGTGGACCCCAGCGGG - Intergenic
1176163811 20:63662551-63662573 AGGTGTGTGTGCTGGGCTCCCGG + Exonic
1176257729 20:64160843-64160865 GGGTGTGTGCAGAGGCCAGCTGG + Intronic
1176304920 21:5118303-5118325 AGGTGTGGAGGGAGAGCAGCCGG - Intronic
1176946603 21:14989782-14989804 ATGTGTGTGTGGAGGTGAGGAGG + Intronic
1177716002 21:24840453-24840475 AGGTGTGTGGGGAGAGGCGCGGG - Intergenic
1177775403 21:25561426-25561448 AGATGGGAGTGGAGGGCAGGGGG + Intergenic
1177792787 21:25738225-25738247 ATGTGTGTGTTGGGGGCAGGGGG - Intronic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1179187165 21:39093922-39093944 AGGTGTGGGGTGAAGGCAGCAGG - Intergenic
1179348228 21:40581555-40581577 AGGTGTGAGAGGAGGGGAGTGGG + Intronic
1179421254 21:41238466-41238488 AGGGGTGTGTGCAGGGCTCCTGG + Intronic
1179493071 21:41754268-41754290 TGGTGTGCGTAGAGTGCAGCAGG - Intronic
1179852134 21:44143727-44143749 AGGTGTGGAGGGAGAGCAGCCGG + Intronic
1179890312 21:44331822-44331844 ACGTGAGGCTGGAGGGCAGCGGG - Exonic
1180109706 21:45642397-45642419 AGCTGGGTGTGGGGGGCGGCAGG - Intergenic
1180228232 21:46411018-46411040 AGGTGGGTGTGGAGTGCATCCGG + Intronic
1181282609 22:21730634-21730656 GGATGTGTGTGGATGGAAGCTGG - Intronic
1181492302 22:23268229-23268251 GGGTGCGTGGGGAGGGGAGCAGG + Intronic
1181641745 22:24204399-24204421 AGAGCAGTGTGGAGGGCAGCTGG - Intergenic
1182458434 22:30467711-30467733 AGGTGTGTGTGGTGGGAACTAGG + Intronic
1183001617 22:34864339-34864361 AGGTGTGTATGGAGGGTGGGCGG - Intergenic
1183776777 22:39971312-39971334 AGGGGTGTGTGGAAGGCAGTGGG + Exonic
1183978582 22:41526997-41527019 AGGTGTGTGTGGAGGGAGGTTGG - Exonic
1184240972 22:43211107-43211129 TGGTGGGTGTGGAGGGGTGCAGG + Intronic
1184255937 22:43287034-43287056 GGGTGTGTGATGGGGGCAGCGGG + Intronic
1184271558 22:43387380-43387402 CGGTGACTGTGGAGGCCAGCAGG - Intergenic
1184320193 22:43735734-43735756 AGGTGTGTGTGTGTGGCAGGGGG + Intronic
1184407061 22:44306273-44306295 TGGCGTGTGTGGAGGGGACCTGG + Intronic
1184407098 22:44306453-44306475 TGGTGTGTGTGGAGGAGACCTGG + Intronic
1184407133 22:44306633-44306655 TGGCGTGTGTGGAGGGGACCTGG + Intronic
1184407143 22:44306678-44306700 TGGTGTGTGTGGAAGGGACCTGG + Intronic
1184407175 22:44306811-44306833 CGGCGTGTGTGGAGGGGACCTGG + Intronic
1184407205 22:44306946-44306968 TGGCGTGTGTGGAGGGGACCTGG + Intronic
1184407214 22:44306991-44307013 TGGCGTGTGTGGAGGGGACCTGG + Intronic
1184490184 22:44803814-44803836 AGGTGTGTGTGTATGAGAGCAGG - Intronic
1184986943 22:48142213-48142235 TGGGGTCTGTCGAGGGCAGCTGG + Intergenic
1185095410 22:48803625-48803647 GGCTGTTTGAGGAGGGCAGCTGG + Intronic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185295377 22:50050548-50050570 AGGTGGGGGAGGAGGGCAGCAGG - Intronic
950471811 3:13191001-13191023 AGGGGTGTGTTGGGGGCAGGAGG - Intergenic
950472748 3:13196780-13196802 GTGTGTGTGTGGTGGGGAGCAGG + Intergenic
950492444 3:13314277-13314299 AGGTCAGTGTGGAGAGGAGCAGG - Intergenic
950722191 3:14891326-14891348 AGGGTTGTGAGTAGGGCAGCAGG - Intronic
950899626 3:16486069-16486091 AGGTGGGTGTGCTGGGCACCTGG - Intronic
951792756 3:26504501-26504523 AGGACTGTGGGGTGGGCAGCTGG + Intergenic
952337943 3:32421054-32421076 GGGTGGGAGAGGAGGGCAGCAGG - Intronic
953095493 3:39770537-39770559 AGGTGTGTGTGGGGGGGCGGGGG - Intergenic
953279206 3:41536435-41536457 TGGGGGGTGTGGAGGGCAGTTGG - Intronic
953699598 3:45185556-45185578 GTGTGTGTGTGGAAGGAAGCTGG + Intergenic
953748861 3:45594766-45594788 GTGTGTGTGTTGAGGGCAGCGGG - Intronic
953830110 3:46289709-46289731 AGATGGGTGTGGAGAGCAGAGGG + Intergenic
954105654 3:48408569-48408591 GGATGTGTGAGGAGGGGAGCTGG - Intronic
954333421 3:49902771-49902793 AGGCGTGTGTGCAGGGCACTAGG + Exonic
954411879 3:50374380-50374402 AGGTGGGTGGGGAGGGGAGGGGG + Intronic
954581113 3:51703404-51703426 AAATGTGGGGGGAGGGCAGCAGG + Intronic
954906274 3:54065797-54065819 AGGAGTCTGTGGAGGCAAGCAGG + Intergenic
955404894 3:58619861-58619883 ATGTGTGTGTGGTGGGGAGGTGG + Intronic
956203324 3:66730192-66730214 AGGTGTGTGAATAGGGCATCTGG + Intergenic
956305631 3:67821331-67821353 AGGTGTGTCTGGATGCAAGCTGG - Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956782982 3:72619026-72619048 CGGTTTCTGAGGAGGGCAGCTGG + Intergenic
957043022 3:75351475-75351497 AGGAGAGTGTGGTGGGCAGATGG - Intergenic
958037529 3:88187932-88187954 GGGGGTGGGTGGAGGGCTGCGGG + Intergenic
959024837 3:101229317-101229339 TGGTGTGTGTGTGGGGGAGCAGG - Intronic
959430908 3:106253933-106253955 AAGTGTGTTTGGAGGGTAGCTGG - Intergenic
960694919 3:120386725-120386747 AGGTATGTGCTGAGGGCTGCTGG + Intergenic
960761137 3:121074865-121074887 ATGTGTGATTGGAGGACAGCAGG - Intronic
961197408 3:125014512-125014534 GAGTGTGTGTGGAGGGCTGGGGG + Intronic
961454954 3:127019404-127019426 AGGTGTGTGTTGGGGCCAGGTGG + Intronic
962202608 3:133414070-133414092 AGGGGTTTGTGGAGGGGAGAGGG - Intronic
962202952 3:133415377-133415399 AGGGGTTTGTGGAGGGGAGAGGG - Intronic
962395873 3:135015011-135015033 AGGTGTGTGTGGAGGAGAGTGGG + Intronic
962606294 3:137035390-137035412 GGGTGTGTGAGGGGGGCATCGGG + Intergenic
962805986 3:138928277-138928299 AGGTGTGTGTGGAAGGCATGCGG + Intergenic
965623066 3:170659791-170659813 AGGCGTGTTTTGAGGGCAGGAGG + Intronic
966855766 3:184193032-184193054 AGGTGTGGCTGGAGGGCACAGGG + Intronic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
967055188 3:185824590-185824612 AGCTGTGGGGGGAGGGGAGCGGG + Intronic
968366792 3:198191735-198191757 AGATGTGCGTGGAGGTGAGCTGG + Intergenic
968443200 4:634828-634850 ATGTGAGTGTGGGGGGCACCTGG + Exonic
968483585 4:848294-848316 AGGAAGGTGTGGAGTGCAGCAGG - Intergenic
968483599 4:848354-848376 GGTTATGTGTGGAGAGCAGCGGG - Intergenic
968565532 4:1310725-1310747 ATGTCTGAGTGGAGGGCAGCTGG + Intronic
968882468 4:3308509-3308531 AGGTGTATGGGGAGAACAGCTGG + Intronic
969026549 4:4177757-4177779 AGGAGAGTGTGGTGGGCAGATGG - Intergenic
969497514 4:7534605-7534627 GGGTCCTTGTGGAGGGCAGCAGG + Intronic
969912407 4:10458112-10458134 AGGTGTATCTAGAGGGCAGTTGG - Intergenic
971082193 4:23226464-23226486 AGATGTGTGTCCAGGGCAGAAGG + Intergenic
971222913 4:24725549-24725571 AGGTGTGTGTGGACAGCACCTGG + Intergenic
971912572 4:32813359-32813381 AGGTGAGAGTTGAGGGCATCTGG - Intergenic
972430286 4:38975216-38975238 GGATGTGTGTGGAGGAGAGCAGG - Intronic
972610328 4:40650322-40650344 AGGGGTGTGGGGAGTGCAGCAGG - Intergenic
972840478 4:42924327-42924349 GGGTGTGTGTGTAAGGCACCTGG + Intronic
974629086 4:64459577-64459599 AATTGTGTGTAGAGGGCAGAAGG + Intergenic
975544657 4:75548533-75548555 AAGAGTGTGTGGAGGGGGGCTGG - Intronic
975661117 4:76689701-76689723 TGGTGAGTGAGGAGGGCGGCTGG + Intronic
977310558 4:95381907-95381929 AGGTGTGTGTATGGGGCAGTTGG + Intronic
977826926 4:101543576-101543598 GGGTGTGTGTTGAGGGCAGGGGG + Intronic
977964374 4:103126435-103126457 AGGTGTGTGTGGTGGGTGGCAGG - Intronic
978761011 4:112356530-112356552 AGGTGTGTGTGCTGGGCTCCCGG + Intronic
979069652 4:116185891-116185913 AGGAGAGTGTGGAGGCCAGTAGG - Intergenic
979100907 4:116613004-116613026 AAGTGTGTGTGGGGGGGAGGGGG - Intergenic
979255205 4:118601344-118601366 AGATGTGAGTGGAGGTGAGCTGG + Intergenic
979333132 4:119439164-119439186 AGATGTGGGTGGAGGTGAGCTGG - Intergenic
979701573 4:123674091-123674113 TGGTGTGAGTGGAGGGGAGGAGG - Intergenic
980582366 4:134771702-134771724 TGGTGTGTGTGGAAGACAGAGGG - Intergenic
981443208 4:144806627-144806649 TGGTGTGTGTGGATGACTGCTGG - Intergenic
981845457 4:149162725-149162747 AGGTGTGTGTGGGGGGTGGGTGG + Intergenic
982380438 4:154743133-154743155 GGGTGTGTGTGTAGGGCGGGGGG - Intronic
983376194 4:166931321-166931343 AGGTGTGTGTGGGGGGTGGGGGG + Intronic
983511112 4:168610459-168610481 GGTTGTGTGTGGAGGGGTGCTGG + Intronic
984138308 4:175969805-175969827 AAGTGTGTGTGGAGGGATGCAGG + Intronic
984589425 4:181600699-181600721 GGGTGTGTGTCTACGGCAGCAGG - Intergenic
984864545 4:184270469-184270491 AGGTGTGTGTTCAGGGAAGGAGG - Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985516001 5:344908-344930 AGGTGTGTGTGGAGGGCTGTGGG + Intronic
985624322 5:977207-977229 AGGAGTGTGGGGTGGGCAGTGGG - Intergenic
986229828 5:5852960-5852982 AGATGTGGGCAGAGGGCAGCAGG + Intergenic
987025376 5:13921731-13921753 GGGTGTGTGTGGGCGGCAGATGG - Intronic
988548174 5:32176658-32176680 GGCTGGGGGTGGAGGGCAGCTGG - Intergenic
988548192 5:32176689-32176711 GGGTGGGGGTGGAGGGCAGCTGG + Intergenic
989153694 5:38324373-38324395 GGGTATGTGTGGAGGGGGGCAGG - Intronic
990434762 5:55777583-55777605 AGGTGTCGGGGGAGGGCAGGTGG + Intronic
990782302 5:59378870-59378892 GGATGTGTGTGGAGAGGAGCTGG - Intronic
990864032 5:60360493-60360515 AGATGTGTGTGGTGGTAAGCTGG - Intronic
992018621 5:72600256-72600278 AGGTGTCTGTTAAGGGAAGCAGG - Intergenic
992638402 5:78747472-78747494 GGGGGTGTGTGGTGGGCACCTGG - Intronic
993398033 5:87414920-87414942 AGGTGTGGGTGGAGGGTAGAAGG - Intergenic
993492645 5:88570563-88570585 AGATGGGTGTGGAGAGAAGCTGG + Intergenic
994177724 5:96729984-96730006 AGCTGTGACTGCAGGGCAGCAGG + Intronic
996423264 5:123285654-123285676 AGGGGTGGGTGGAGGGCAGGAGG - Intergenic
997089956 5:130845023-130845045 AGGTGTGAGTGAAGGACAACAGG + Intergenic
998109890 5:139493083-139493105 TGATGTGTGTGCAGAGCAGCAGG + Intergenic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
998874966 5:146590082-146590104 AAGTGTGTGTGGGGGGCAAGCGG - Exonic
999211785 5:149895933-149895955 AGGTATGTGTGGGAGGCAGTGGG - Intronic
999459176 5:151742925-151742947 AGGTCTGTCTGGAAGCCAGCGGG + Exonic
999742721 5:154568825-154568847 CGGGCTGTGTGGAGGGCACCTGG - Intergenic
1000012843 5:157248956-157248978 AGACGTGTGTGGAGGCCAGCCGG - Exonic
1000795892 5:165663912-165663934 GTGTGTGTGTGGAGGGGTGCTGG + Intergenic
1001313794 5:170629049-170629071 AGGTGGGAGTGGAGGGCGGGAGG - Intronic
1001910521 5:175513785-175513807 GGGCGTGTGGGTAGGGCAGCCGG + Intronic
1002101680 5:176860999-176861021 AGATGGGTGTGGAGGGCATTTGG - Intronic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1002403353 5:179007347-179007369 AAGTGTGTGCTGAGGGCAACAGG - Intergenic
1002426912 5:179181978-179182000 GGGTGTGTGCGGTGGGAAGCTGG - Intronic
1002441113 5:179265065-179265087 GGGTGAGTGGGGTGGGCAGCGGG - Intronic
1002726015 5:181296935-181296957 AGATGTGCGTGGAGGTGAGCTGG + Intergenic
1003487974 6:6595879-6595901 AGCAGTGTGTGGAGGGCTGTGGG + Intronic
1003761429 6:9182732-9182754 ATATGTGTGAGGAGGGCAGGGGG + Intergenic
1004440072 6:15641719-15641741 AGGTGTGTTTGCAGGGAATCTGG - Intronic
1005631049 6:27708395-27708417 AGATGTTTGGGGAGGGCAGATGG - Intergenic
1005871459 6:29976884-29976906 AGGTGTGAGTGCCGCGCAGCTGG - Intergenic
1006070415 6:31494361-31494383 AGGTGTGAGTGCCGCGCAGCTGG + Intergenic
1006214075 6:32423813-32423835 AGGAGTGTGTGAATGGCATCTGG + Intergenic
1006448171 6:34091431-34091453 GGGTGAGGGTGGAGGGCCGCGGG - Intronic
1006584057 6:35094059-35094081 AGGTGTCAGTGGAGGCCAGGTGG + Intergenic
1006835775 6:36998059-36998081 TCGTCAGTGTGGAGGGCAGCGGG + Intergenic
1006902765 6:37513656-37513678 AGGTGCGAGTGCAGGGGAGCCGG + Intergenic
1007063870 6:38969699-38969721 AGGTGTGTGTGGGGGGGAGTGGG + Intronic
1007295331 6:40816745-40816767 AGGTGAATGTGAAGGCCAGCCGG + Intergenic
1007767083 6:44166931-44166953 TGTTGTGTGGGGAGGGCGGCGGG + Intronic
1008663353 6:53692512-53692534 AAGTGCGTGTGAATGGCAGCAGG - Intergenic
1008911145 6:56734831-56734853 AGGTTTATGTGGATGGCAGAAGG - Intronic
1009290725 6:61878188-61878210 ATGTGTCTATGCAGGGCAGCAGG - Intronic
1010124715 6:72418800-72418822 AGGCGGGTGTTCAGGGCAGCAGG + Intergenic
1011493375 6:87915348-87915370 ATGTGTGTGTGGAGGGTGGGAGG + Intergenic
1013370588 6:109467436-109467458 TGGTGTGAGTGGAGTGCAGGTGG - Intronic
1013374022 6:109496709-109496731 AGTTATGTGGGGAAGGCAGCGGG - Intronic
1013422684 6:109980054-109980076 AGTTGTAGGTGGCGGGCAGCAGG - Exonic
1013658497 6:112270384-112270406 CAGTGTGTCTGGTGGGCAGCTGG + Intergenic
1013874451 6:114806289-114806311 AGGTGTGGGAGGAGGGGAGGAGG - Intergenic
1015770251 6:136761402-136761424 AGGGCTGTGTGGAGGACAGAAGG + Intronic
1016501639 6:144726989-144727011 AGGGGTGTGGGGAGGGAAGAGGG - Intronic
1016607549 6:145949342-145949364 AAATGTGTGTGGAGGGGGGCAGG + Intronic
1016831919 6:148442542-148442564 TGGTGTATGTGGGGGGCAGGGGG - Intronic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1018798906 6:167207672-167207694 AGGTGTGGGTGGAGGACTGAAGG + Intergenic
1019033645 6:169035193-169035215 TGATGTGGGCGGAGGGCAGCAGG - Intergenic
1019101600 6:169635223-169635245 AGGTGTGGTTGGGGGGCAGGTGG + Intronic
1019134253 6:169898253-169898275 AGGTGTCTGTGCAGGGCCGAGGG - Intergenic
1019194729 6:170274509-170274531 AGGTGTGTGGGGTGGGGAGCAGG + Intergenic
1019407733 7:892580-892602 AGGTGTGTGTGCAGGTCTGTTGG + Intronic
1019429338 7:991464-991486 AGGGGTGTGGGGCGGGCAGGAGG + Intergenic
1019478201 7:1254311-1254333 CGGTGGGTGGGGAGGGCCGCTGG - Intergenic
1019607029 7:1915122-1915144 AGGTATGTGTGGAGAGGTGCTGG + Intronic
1020108096 7:5431791-5431813 AAGAGAGAGTGGAGGGCAGCCGG - Intronic
1020789184 7:12604728-12604750 GTGTGTGTGTGTAAGGCAGCAGG + Intronic
1021261495 7:18463360-18463382 AGGTGTGTGTGTGGGGCAAGGGG + Intronic
1021530096 7:21634657-21634679 AGTTGAGAGTGGAGGGCAGGAGG + Intronic
1021691766 7:23237100-23237122 GTGTGTGTGTGTTGGGCAGCAGG - Intronic
1021874137 7:25032817-25032839 AAGTGTGAGTGGGGGGCAACAGG + Intergenic
1022033381 7:26512652-26512674 TGTTGTGTGTGGTGGGGAGCAGG + Intergenic
1023654463 7:42405988-42406010 AGGAGTGTCTGGAGGGCATTGGG + Intergenic
1023780511 7:43650970-43650992 AGGGGTCAGTGGGGGGCAGCAGG + Intronic
1023863071 7:44227006-44227028 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1023863314 7:44227709-44227731 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1024070908 7:45784502-45784524 AGATGTGGGTGGAGGTGAGCTGG + Intergenic
1024682171 7:51703537-51703559 AGGTGGTTGTGGATGGCAGGAGG + Intergenic
1025801322 7:64789218-64789240 AGGTGTGGGAGGAGGGCAGCAGG - Intergenic
1026912055 7:74096768-74096790 AGGTGAGTGTGCAAGGCAGGGGG - Intronic
1027481970 7:78709284-78709306 AGGTGTGTGTGGAGTGGGGGTGG - Intronic
1028713179 7:93934387-93934409 AGGGGTGGGTGGAAGGCAGAGGG - Intergenic
1029157211 7:98525838-98525860 AGGTTTGTGTGGATGGCACTTGG + Intergenic
1029346189 7:99980482-99980504 AGGTGTGTGTGATGGGTGGCAGG - Intergenic
1029485251 7:100836299-100836321 AGATGTGTGTGGGGAGGAGCAGG + Intronic
1029558988 7:101290033-101290055 AGGTGTGTGTGATGGGTGGCAGG + Intergenic
1029953598 7:104613602-104613624 AGGGGTGAGTGGAGGGTAGATGG - Intronic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1030935874 7:115584759-115584781 AGGTGTGTGTTTGGGGGAGCAGG - Intergenic
1031813432 7:126401712-126401734 AGGTGTATGTGAAAGGCAGGGGG + Intergenic
1031941461 7:127793797-127793819 AGGTGAGGGTGGAGGGGAGGAGG - Intronic
1031987776 7:128174491-128174513 CGGTGTGTGCTGAGAGCAGCGGG + Intergenic
1032003601 7:128282670-128282692 AGCTGTGTGTGGCGGCCATCCGG - Intergenic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032720885 7:134550118-134550140 AGGTGAGTAAGGAGGTCAGCAGG - Intronic
1033027387 7:137788688-137788710 ATGTGTGTGTGTATGGCAGGGGG - Intronic
1033111634 7:138583669-138583691 CAGTGTGTGTGGAAGGCAGTGGG + Intronic
1033318160 7:140315676-140315698 AGTTCAGTGTTGAGGGCAGCGGG + Intronic
1033771470 7:144557392-144557414 TAGTGTGTGTGGAGAGCAGAAGG - Intronic
1034102023 7:148458218-148458240 AGGTGTGTCTGGAAAGTAGCTGG - Intergenic
1034275606 7:149822512-149822534 AGGAGTGTGTGTGGAGCAGCTGG + Intergenic
1034405423 7:150899555-150899577 GGGGCTGTGTGGAGGGAAGCAGG - Intergenic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034459672 7:151191499-151191521 AAATGTGTGTGGAGCTCAGCTGG - Intronic
1035063558 7:156088894-156088916 AGGGGTATGTGGTGGGCAACGGG + Intergenic
1035259736 7:157653795-157653817 GGGTGGGTGTGGGGAGCAGCGGG - Intronic
1035259779 7:157653947-157653969 GGGTGGGTGTGGGGAGCAGCGGG - Intronic
1035746251 8:1963715-1963737 AGGGGTGTGTGGAGGGCGCTGGG + Intergenic
1036086533 8:5618645-5618667 GGGTGTGTGTGTGGGGGAGCGGG + Intergenic
1036086548 8:5618699-5618721 GGGTGTGTGTGTGGGGGAGCGGG + Intergenic
1036143253 8:6227527-6227549 GGGGGTGTGAGGGGGGCAGCAGG - Intergenic
1036392545 8:8336884-8336906 AGGGGTGTGGGGAGGGGAGTGGG - Intronic
1037001625 8:13726376-13726398 AGGTTTCTTTGGAAGGCAGCTGG - Intergenic
1037510468 8:19576994-19577016 AGGTGGGTGTGGAGGGCGAGAGG - Intronic
1037542832 8:19888794-19888816 AGCTGTGGGTGGAGAGGAGCTGG - Intergenic
1037814526 8:22104911-22104933 AGATGTGTGTGGAGGGGTGGGGG + Intergenic
1037837184 8:22221217-22221239 AGGGGCGAGGGGAGGGCAGCTGG + Exonic
1037916620 8:22777062-22777084 AGGTGAGTGTGCAGAGAAGCAGG + Intronic
1038250837 8:25902903-25902925 ATGGGTGTGTGGTGAGCAGCAGG + Intronic
1038259300 8:25979248-25979270 AGGGGTATGTGGAGGCCAGGTGG + Intronic
1038307749 8:26420052-26420074 TGGTGGGCGTGGAGGGCAGGAGG - Intronic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1038796564 8:30715579-30715601 AGGTGTGGGTGGAAGGCACGGGG - Intronic
1039058676 8:33556461-33556483 GTGTGTGTGTGGTGGGCAGGGGG + Intronic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1039186249 8:34919923-34919945 AAGTGTTTGTGGAAAGCAGCTGG - Intergenic
1039615374 8:38951087-38951109 GGGTGGGAGTGGGGGGCAGCTGG + Intronic
1039641720 8:39230036-39230058 AGGTGTGCATGGATGGCACCAGG - Intronic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1040407615 8:47121803-47121825 ACTTGAGGGTGGAGGGCAGCAGG + Intergenic
1041472918 8:58231103-58231125 AGTTCTGTGTGGATGGAAGCCGG + Intergenic
1041732044 8:61072194-61072216 AGCTGGGTGTTGAAGGCAGCGGG - Intronic
1041948307 8:63471997-63472019 AGGTGTATGTGGAGTGGAGAGGG + Intergenic
1042127209 8:65550287-65550309 AGGGTTGTGTGTGGGGCAGCAGG + Intergenic
1042422299 8:68605952-68605974 TGGTGTGTGTGGGGGGCAGGAGG + Intronic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1043171499 8:76972344-76972366 CGGTGTGGGTGGGGGGCAGCAGG + Intergenic
1044045987 8:87432848-87432870 AGATGTCTGTGCAGGGCAACAGG - Intronic
1044618088 8:94162827-94162849 AGATGTGTGTGGAGTGCAGGTGG + Intronic
1044874402 8:96650156-96650178 AGGTGTGGGTGCTGGGCAGAGGG + Intronic
1046801761 8:118436383-118436405 AGGTTGGTGTAGAGGGCAGCAGG + Intronic
1046968645 8:120195383-120195405 AAGTGTGTGTGGCGGGCAGAGGG - Intronic
1047230856 8:122996639-122996661 ATGTGTGTGTGGAGGGCTGTGGG - Intergenic
1047492844 8:125388664-125388686 AGGGGTGGGGGGAGGGGAGCGGG - Intergenic
1048279676 8:133095909-133095931 AGGTGGGTGAGGAAGGCAGGAGG - Intronic
1048742802 8:137580671-137580693 AGGTGTGTACTGAGGGCAGCAGG - Intergenic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049443087 8:142618051-142618073 AGGTGTGTGTGGCCAGCAGTGGG - Intergenic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049464001 8:142742853-142742875 AGGTCTGTGGAGAGGGCTGCAGG - Intergenic
1049661198 8:143820410-143820432 AGGTAACTGCGGAGGGCAGCCGG - Intronic
1049845212 8:144797485-144797507 AAGTGTGTGTGGAGGTGAGTGGG + Intergenic
1050872772 9:10594765-10594787 AGGTGTGTGGTAGGGGCAGCTGG + Intronic
1051406173 9:16739985-16740007 AGGTCTGTGTAGATGGCTGCTGG - Intronic
1051595310 9:18819044-18819066 AGGTGTGTGTTGAGGGGTGATGG - Intronic
1051726550 9:20092721-20092743 ATTTGTGTGTGCAGGGCAGGGGG + Intergenic
1052237905 9:26234934-26234956 TGGTGTGGGTGGAGTGCCGCTGG - Intergenic
1052237911 9:26234959-26234981 TGGTGTGGGTGGAGTGCCGCTGG - Intergenic
1053165573 9:35841567-35841589 TGGTGTGTGTGGGGGGCCGTGGG + Exonic
1053661343 9:40283653-40283675 AGGGGTGTGTGGAAGGCAGAAGG + Intronic
1053911718 9:42912999-42913021 AGGGGTGTGTGGAAGGCAGAAGG + Intergenic
1054373462 9:64429871-64429893 AGGGGTGTGTGGAAGGCAGAAGG + Intergenic
1054523267 9:66092631-66092653 AGGGGTGTGTGGAAGGCAGAAGG - Intergenic
1054681091 9:67919642-67919664 AGCGGTGTGTGGAAGGCAGAAGG + Intergenic
1056532212 9:87497871-87497893 CGGAGTGTGAGGAGGACAGCCGG + Exonic
1056805792 9:89727616-89727638 AGGGGGGTGTGGAGGGGAGATGG + Intergenic
1057314319 9:93958889-93958911 GGGTGTGGGTGGAGGGGAGGTGG - Intergenic
1058381732 9:104384296-104384318 AGGTGTGGTTGGAGGGAGGCAGG - Intergenic
1059008939 9:110435467-110435489 AGATGGGGGTGGAGGGAAGCAGG + Intronic
1059408671 9:114118359-114118381 AAGTGTGTGTGCAGGGGAGGGGG - Intergenic
1060002698 9:119973116-119973138 AGGTGTCTGTTAAGGGCAGAGGG - Intergenic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060403230 9:123360440-123360462 GGCGGGGTGTGGAGGGCAGCAGG - Intronic
1060954542 9:127629221-127629243 GGGAGTGTGTGGAGAGCAGTCGG + Intronic
1060967976 9:127722223-127722245 AGGTGTGGGTGGAGGGAGGGAGG - Intronic
1062025849 9:134340292-134340314 AGGGGGCTGTGGAGGGCTGCAGG + Intronic
1062342397 9:136099618-136099640 TGGTGTGTGTGCGGGGCGGCGGG + Intergenic
1062353258 9:136149289-136149311 AGGTGTGGGAGGAGGGCCGGGGG - Intergenic
1062540614 9:137040201-137040223 AGGTGAGGGTGCAGGGCGGCGGG + Intronic
1062623512 9:137433136-137433158 CCCTGTGGGTGGAGGGCAGCCGG - Intronic
1062751149 9:138254579-138254601 AGATGTGCGTGGAGGTGAGCTGG + Intergenic
1185451991 X:286856-286878 AGGTGGGGGTAGGGGGCAGCAGG + Intronic
1186137026 X:6532793-6532815 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137047 X:6532852-6532874 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137070 X:6532915-6532937 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137089 X:6532974-6532996 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137120 X:6533066-6533088 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137143 X:6533129-6533151 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137154 X:6533159-6533181 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137178 X:6533225-6533247 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137189 X:6533255-6533277 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137230 X:6533376-6533398 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137254 X:6533442-6533464 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1186267175 X:7844263-7844285 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267220 X:7844388-7844410 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267243 X:7844451-7844473 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267256 X:7844484-7844506 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186297728 X:8169142-8169164 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297740 X:8169175-8169197 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186324870 X:8466597-8466619 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324880 X:8466626-8466648 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324913 X:8466718-8466740 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324923 X:8466747-8466769 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324933 X:8466776-8466798 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324943 X:8466805-8466827 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324965 X:8466867-8466889 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324976 X:8466897-8466919 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324987 X:8466927-8466949 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325034 X:8467055-8467077 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325046 X:8467088-8467110 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325085 X:8467205-8467227 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325115 X:8467292-8467314 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325131 X:8467329-8467351 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186376959 X:9014031-9014053 ATGTGTGTGTGGGGGGGAGGAGG - Intergenic
1186416908 X:9391777-9391799 GGCTGTGGGTGGAGGGCAACGGG + Intergenic
1186750496 X:12616721-12616743 AGATGTGTGTGGGTGTCAGCAGG + Intronic
1187222170 X:17338693-17338715 AGCTGTGTGTGGAGCACAGGGGG + Intergenic
1187255011 X:17634709-17634731 TGGTGTGTGTTGAGGGCGGGTGG + Intronic
1187305696 X:18093461-18093483 AGGTGTATGTGGAGGGAATGTGG + Intergenic
1187472997 X:19585958-19585980 TGGAGTGTGTGGAGGGCTGGGGG + Intronic
1188244626 X:27824871-27824893 AGTTATTTGTGTAGGGCAGCTGG - Intergenic
1188728787 X:33619801-33619823 AGGGGTGTGTGGAACACAGCTGG + Intergenic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1189754794 X:44260107-44260129 AGTTGTCTGTGGTGGGGAGCGGG + Intronic
1190274328 X:48890731-48890753 GGGTGTGGGTGGGCGGCAGCCGG + Intergenic
1190542710 X:51495625-51495647 AGGTGTGTGTGGGGGGCGAGGGG - Intronic
1192202956 X:69078512-69078534 AGAGGAGGGTGGAGGGCAGCTGG - Intergenic
1192260640 X:69504367-69504389 AAGTGTGTTTGGCGGGGAGCAGG - Intergenic
1192554623 X:72079934-72079956 GGCTGTGGGTGGAGTGCAGCGGG + Intergenic
1194608864 X:96015684-96015706 ATGTGTGTGTGGAGGGGGGTGGG - Intergenic
1194657994 X:96597004-96597026 AGGTGTGTGTGCAGGGAAGGGGG - Intergenic
1195264209 X:103164289-103164311 TGGTGTGTGTGGAGGGGAATGGG + Intergenic
1196044758 X:111245780-111245802 AGGTGTGTGTGGATGGGTGGGGG + Exonic
1198677593 X:139147320-139147342 AGATGTGTGTGGTGGGGAGATGG - Intronic
1198972114 X:142293437-142293459 ATGTGTGTGTGGGGGGGGGCCGG + Intergenic
1199033098 X:143024028-143024050 GGTTGTGTTTGGAGGTCAGCAGG + Intergenic
1200218586 X:154379628-154379650 AGGCGCGCGGGGAGGGCAGCGGG - Intronic
1200254918 X:154575471-154575493 AGGAAAGCGTGGAGGGCAGCTGG + Intergenic
1200262851 X:154628937-154628959 AGGAAAGCGTGGAGGGCAGCTGG - Intergenic
1200425458 Y:3015611-3015633 ATGTGTGTGTGGGGGACAGGGGG + Intergenic
1200775594 Y:7167482-7167504 ATGTGTGTGGCGAGGGGAGCAGG + Intergenic
1201438516 Y:13985245-13985267 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201438532 Y:13985300-13985322 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201438667 Y:13985696-13985718 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201445906 Y:14057012-14057034 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201446041 Y:14057408-14057430 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201446057 Y:14057463-14057485 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1202391504 Y:24375052-24375074 GGGTGTGTGTGGAGTGTAGAGGG - Intergenic
1202479281 Y:25295065-25295087 GGGTGTGTGTGGAGTGTAGAGGG + Intergenic