ID: 1040048579

View in Genome Browser
Species Human (GRCh38)
Location 8:42989119-42989141
Sequence CAATATTAGAAGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040048572_1040048579 -7 Left 1040048572 8:42989103-42989125 CCTGCCAATCCTCAAACAATATT 0: 1
1: 0
2: 0
3: 12
4: 200
Right 1040048579 8:42989119-42989141 CAATATTAGAAGAGGGTGGAGGG No data
1040048571_1040048579 25 Left 1040048571 8:42989071-42989093 CCAAGAGTGAGCACTTTAGTGTA 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1040048579 8:42989119-42989141 CAATATTAGAAGAGGGTGGAGGG No data
1040048570_1040048579 26 Left 1040048570 8:42989070-42989092 CCCAAGAGTGAGCACTTTAGTGT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1040048579 8:42989119-42989141 CAATATTAGAAGAGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040048579 Original CRISPR CAATATTAGAAGAGGGTGGA GGG Intronic
No off target data available for this crispr