ID: 1040054322

View in Genome Browser
Species Human (GRCh38)
Location 8:43044256-43044278
Sequence CACTGCCGCCTCTCCCTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64657
Summary {0: 1, 1: 2, 2: 204, 3: 5852, 4: 58598}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040054322_1040054325 19 Left 1040054322 8:43044256-43044278 CCCAAGAGGGAGAGGCGGCAGTG 0: 1
1: 2
2: 204
3: 5852
4: 58598
Right 1040054325 8:43044298-43044320 CACTCCAGCCTGAGCGACAGAGG 0: 68
1: 2268
2: 7936
3: 8490
4: 6108
1040054322_1040054326 20 Left 1040054322 8:43044256-43044278 CCCAAGAGGGAGAGGCGGCAGTG 0: 1
1: 2
2: 204
3: 5852
4: 58598
Right 1040054326 8:43044299-43044321 ACTCCAGCCTGAGCGACAGAGGG 0: 60
1: 2127
2: 7242
3: 6867
4: 6059

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040054322 Original CRISPR CACTGCCGCCTCTCCCTCTT GGG (reversed) Intronic
Too many off-targets to display for this crispr