ID: 1040054325

View in Genome Browser
Species Human (GRCh38)
Location 8:43044298-43044320
Sequence CACTCCAGCCTGAGCGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24870
Summary {0: 68, 1: 2268, 2: 7936, 3: 8490, 4: 6108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040054322_1040054325 19 Left 1040054322 8:43044256-43044278 CCCAAGAGGGAGAGGCGGCAGTG 0: 1
1: 2
2: 204
3: 5852
4: 58598
Right 1040054325 8:43044298-43044320 CACTCCAGCCTGAGCGACAGAGG 0: 68
1: 2268
2: 7936
3: 8490
4: 6108
1040054323_1040054325 18 Left 1040054323 8:43044257-43044279 CCAAGAGGGAGAGGCGGCAGTGA 0: 1
1: 4
2: 393
3: 9757
4: 83922
Right 1040054325 8:43044298-43044320 CACTCCAGCCTGAGCGACAGAGG 0: 68
1: 2268
2: 7936
3: 8490
4: 6108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040054325 Original CRISPR CACTCCAGCCTGAGCGACAG AGG Intronic
Too many off-targets to display for this crispr