ID: 1040054326

View in Genome Browser
Species Human (GRCh38)
Location 8:43044299-43044321
Sequence ACTCCAGCCTGAGCGACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22355
Summary {0: 60, 1: 2127, 2: 7242, 3: 6867, 4: 6059}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040054322_1040054326 20 Left 1040054322 8:43044256-43044278 CCCAAGAGGGAGAGGCGGCAGTG 0: 1
1: 2
2: 204
3: 5852
4: 58598
Right 1040054326 8:43044299-43044321 ACTCCAGCCTGAGCGACAGAGGG 0: 60
1: 2127
2: 7242
3: 6867
4: 6059
1040054323_1040054326 19 Left 1040054323 8:43044257-43044279 CCAAGAGGGAGAGGCGGCAGTGA 0: 1
1: 4
2: 393
3: 9757
4: 83922
Right 1040054326 8:43044299-43044321 ACTCCAGCCTGAGCGACAGAGGG 0: 60
1: 2127
2: 7242
3: 6867
4: 6059

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040054326 Original CRISPR ACTCCAGCCTGAGCGACAGA GGG Intronic
Too many off-targets to display for this crispr