ID: 1040058494

View in Genome Browser
Species Human (GRCh38)
Location 8:43083589-43083611
Sequence ACCTACTCCTCAACTAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040058489_1040058494 22 Left 1040058489 8:43083544-43083566 CCAACCTTTCTGTTTTCATTTCT 0: 1
1: 1
2: 12
3: 179
4: 1836
Right 1040058494 8:43083589-43083611 ACCTACTCCTCAACTAGAAAAGG No data
1040058490_1040058494 18 Left 1040058490 8:43083548-43083570 CCTTTCTGTTTTCATTTCTAGAG 0: 1
1: 0
2: 6
3: 102
4: 1186
Right 1040058494 8:43083589-43083611 ACCTACTCCTCAACTAGAAAAGG No data
1040058492_1040058494 -9 Left 1040058492 8:43083575-43083597 CCGCCTTCAGGTTAACCTACTCC 0: 1
1: 0
2: 1
3: 7
4: 92
Right 1040058494 8:43083589-43083611 ACCTACTCCTCAACTAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040058494 Original CRISPR ACCTACTCCTCAACTAGAAA AGG Intronic
No off target data available for this crispr